$ echo UCCACGGCUGUUAGUGGAUAACGGC | RNAsubopt --noLP -s -e 10 > barseq.sub $ barriers -G RNA-noLP --bsize --rates < barseq.sub > barseq.barYou can restrict the number of local minima using the barriers command-line option -max followed by a number. The option -G RNA-noLP instructs barriers that the input consists of RNA secondary structures without isolated basepairs. -bsize adds size of the gradient basins and -rates tells barriers to compute rates between macro states/basins for use with treekin. Another useful options is -minh to print only minima with a barrier . Look at the output file less -S barseq.bar. Use the arrow keys to navigate.
UCCACGGCUGUUAGUGGAUAACGGC 1 ......(((((((.....))))))) -7.00 0 9.70 306 0 -7.253634 66 -7.033551 2 (((((........)))))....... -6.40 1 8.70 49 31 -6.512183 40 -6.512029 3 ....((..((((....)))).)).. -0.60 2 2.70 6 39 -0.801478 19 -0.824413 4 (((...(((...))))))....... -0.30 2 0.90 1 10 -0.300000 14 -0.633640 5 ......................... 0.00 2 0.90 3 14 -0.326648 144 -0.634416 6 ......(((....((.....))))) 0.40 1 0.40 1 21 0.400000 4 0.367865 7 .((....((......)).....)). 0.50 2 0.50 1 21 0.500000 7 0.300247 8 ......((((((....)))...))) 0.80 1 1.50 1 82 0.800000 8 0.716052
The first row holds the input sequence, the successive list the local minima ascending in energy. The meaning of the first 5 columns is as follows