switch.in ((((((((......))))))))....((((((((.......)))))))) ((((((((((((((((((........))))))))))))))))))..... $ switch.pl -n 10 --noLP < switch.in > switch.out
switch.out should look similar like this, the first block represents our bi-stable structures in random order, the second block shows the resulting sequences ordered by their score.
$ less switch.out GUCUGGGAGUGACGUCCCAGAUUUCCGGGGCGUCGUUUCCGGACGCCCC 1.1747 CUGUAGUCAUUGGGGACUACAGAACAGGUUUCUGGUGAUUGCAGGAACC 0.9442 CCCGGUUGUGAGAUCAGCCGGGCACAGCUGGUCUUGUAACUGGGCCAGU 1.3980 [...] the resulting sequences are: CCCGGUUGUGAGAUCAGCCGGGCACAGCUGGUCUUGUAACUGGGCCAGU 1.3980 CGGGCCAGAGUUGCCUGGUCCGAUUGUCAGGCAGUUUUGGCCUGCCUGA 1.3888 AUGAGCUAAGUGUCUGGCUCAUAAAUGUCGGACGUUUAGUUCGUCCGGC 1.3832 [...]
Given all 10 suggestions in our switch.out, we select the one with the best score with some command line tools to use it as an RNAsubopt input file and build up the barriers tree.
$ tail -10 switch.out | awk '{print($1)}' | head -n 1 > subopt.in
$ RNAsubopt --noLP -s -e 10 < subopt.in > subopt.out
$ barriers -G RNA-noLP --bsize --rates --minh 2 --max 30 < subopt.out > barriers.out
tail -10 cuts the last 10 lines from the switch.out file and pipes it into
an awk script. The function print($1) echoes only the first column and this
is piped into the head program where the first line, which equals the best scored
sequence, is taken and written into subopt.in. Then RNAsubopt is called
to process our sequence and write the output to another file which is the input for the
barriers calculation.
Below you find an example of the barriertree calculation above done with the right settings (connected root)
on the left side and the wrong RNAsubobt -e value on the right. Keep in mind that
switch.pl performs an stochastic search and the output sequences are different every time
because there are a lot of sequences which fit the structure and switch calculates a new one
everytime. Simply try to make sure.
left: Barriers tree as it should look like, all branches connected to the main root
right: disconnected tree due to a too low energy range (-e) parameter set in RNAsubopt.
Be careful to set the range -e high enough, otherwise we get a problem when calculation the kinetics using treekin. Every branch should be somehow connected to the main root of the tree. Try -e 20 and -e 30 to see the difference in the trees and choose the optimal value. By using -max 30 we shorten our tree to focus only on the lowest minima and select also a branch preferably outside of the two main branches, here branch 29 (may differ from your own calculation). Look at the barrierstree to find the best branch to start and replace 29 by the branch you would choose. Now use treekin to plot concentration kinetics and think about the graph you just created.
$ treekin -m I --p0 29=1 < barriers.out > treekin.out $ xmgrace -log x -nxy treekin.outThe graph could look like the one below, remember everytime you use switch.pl it can give you different sequences so the output varies too. Here the one from the example.