RNAUP
NAME
RNAup − manual page for RNAup 2.7.0
SYNOPSIS
RNAup [OPTION]...
DESCRIPTION
RNAup 2.7.0
Calculate the thermodynamics of RNA−RNA interactions
RNAup calculates the thermodynamics of RNA−RNA interactions, by decomposing the binding into two stages. (1) First the probability that a potential binding sites remains unpaired (equivalent to the free energy needed to open the site) is computed. (2) Then this accessibility is combined with the interaction energy to obtain the total binding energy. All calculations are done by computing partition functions over all possible conformations.
RNAup provides two different modes: By default RNAup computes accessibilities, in terms of the free energies needed to open a region (default length 4). It prints the region of highest accessibility and its opening energy to stdout, opening energies for all other regions are written to a file.
In interaction
mode the interaction between two RNAs is calculated. It is
invoked if the input consists of two sequences concatenated
with an ’&’, or if the options -X[pf] or -b
are given. Unless the -b option is specified RNAup assumes
that the longer RNA is a structured target sequence while
the shorter one is an unstructured small RNA.
Additionally, for every position along the target sequence
we write the best free energy of binding for an interaction
that includes this position to the the output file. Output
to stdout consists of the location and free energy, dG, for
the optimal region of interaction. The binding energy dG is
also split into its components the interaction energy dGint
and the opening energy dGu_l (and possibly dGu_s for the
shorter sequence).
In addition we print the optimal interaction structure as
computed by RNAduplex for this region. Note that it can
happen that the RNAduplex computed optimal interaction does
not coincide with the optimal RNAup region. If the two
predictions don’t match the structure string is
replaced by a run of "." and a message is written
to stderr.
Each sequence
should be in 5’ to 3’ direction. If the sequence
is preceded by a line of the form
> name
the output file "name_ux_up.out" is produced, where the "x" in "ux" is the value set by the -u option. Otherwise the file name defaults to RNA_ux_up.out. The output is concatenated if a file with the same name exists.
RNA sequences
are read from stdin as strings of characters. White space
and newline within a sequence cause an error! Newline is
used to separate sequences. The program will continue to
read new sequences until a line consisting of the single
character @ or an end of file condition is encountered.
−h, −−help
Print help and exit
−−detailed−help
Print help, including all details and hidden options, and exit
−−full−help
Print help, including hidden options, and exit
−V, −−version
Print version and exit
−v, −−verbose
Be verbose. (default=off)
Lower the log level setting such that even INFO messages are passed through.
I/O Options:
Command line options for input and output (pre−)processing
−o, −−no_output_file
Do not produce an output file.
(default=off)
−−no_header
Do not produce a header with the command line parameters used in the outputfile.
(default=off)
−−noconv
Do not automatically substitute nucleotide "T" with "U".
(default=off)
−−log−level=level
Set log level threshold. (default=‘2’)
By default, any log messages are filtered such that only warnings (level 2) or errors (level 3) are printed. This setting allows for specifying the log level threshold, where higher values result in fewer information. Log−level 5 turns off all messages, even errors and other critical information.
−−log−file[=filename]
Print log messages to a file instead of stderr. (default=‘RNAup.log’)
−−log−time
Include time stamp in log messages.
(default=off)
−−log−call
Include file and line of log calling function.
(default=off)
Algorithms:
Select additional algorithms which should be included in the calculations.
−u, −−ulength=length
Specify the length of the unstructured region in the output.
(default=‘4’)
The probability of being unpaired is plotted on the right border of the unpaired region. You can specify up to 20 different length values: use "−" to specify a range of continuous values (e.g. −u 4−8) or specify a list of comma separated values (e.g. −u 4,8,15).
−c, −−contributions=SHIME
Specify the contributions listed in the output. (default=‘S’)
By default only the full probability of being unpaired is plotted. The −c option allows one to get the different contributions (c) to the probability of being unpaired: The full probability of being unpaired ("S" is the sum of the probability of being unpaired in the exterior loop ("E"), within a hairpin loop ("H"), within an internal loop ("I") and within a multiloop ("M"). Any combination of these letters may be given.
Calculations of RNA-RNA interactions:
−w, −−window=INT
Set the maximal length of the region of interaction.
(default=‘25’)
−b, −−include_both
Include the probability of unpaired regions in both (b) RNAs.
(default=off)
By default only the probability of being unpaired in the longer RNA (target) is used.
−5, −−extend5=INT
Extend the region of interaction in the target to some residues on the 5’ side.
The underlying assumption is that it is favorable for an interaction if not only the direct region of contact is unpaired but also a few residues 5’
−3, −−extend3=INT
Extend the region of interaction in the target to some residues on the 3’ side.
The underlying assumption is that it is favorable for an interaction if not only the direct region of contact is unpaired but also a few residues 3’
−−interaction_pairwise
Activate pairwise interaction mode. (default=off)
The first sequence interacts with the 2nd, the third with the 4th etc. If activated, two interacting sequences may be given in a single line separated by "&" or each sequence may be given on an extra line.
−−interaction_first
Activate interaction mode using first sequence only.
(default=off)
The interaction of each sequence with the first one is calculated (e.g. interaction of one mRNA with many small RNAs). Each sequence has to be given on an extra line
−S, −−pfScale=DOUBLE
In the calculation of the pf use scale*mfe as an estimate for the ensemble free energy (used to avoid overflows).
(default=‘1.07’)
The default is 1.07, useful values are 1.0 to 1.2. Occasionally needed for long sequences.
Structure Constraints:
Command line options to interact with the structure constraints feature of this program
−C, −−constraint
Apply structural constraint(s) during prediction.
(default=off)
The program first reads the sequence(s), then a dot−bracket like string containing constraints on the structure. The following symbols are recognized:
’.’ ... no constraint for this base
’x’ ... the base is unpaired
’<’ ... the base pairs downstream, i.e. i is paired with j > i
’>’ ... the base pairs upstream, i.e. i is paired with j < i
’()’ ... base i pairs with base j
’|’ ... the corresponding base has to be paired intermolecularily (only for
interaction mode)
Energy Parameters:
Energy parameter sets can be adapted or loaded from user−provided input files
−T, −−temp=DOUBLE
Rescale energy parameters to a temperature of temp C. Default is 37C.
(default=‘37.0’)
−P, −−paramFile=paramfile
Read energy parameters from paramfile, instead of using the default parameter set.
Different sets of energy parameters for RNA and DNA should accompany your distribution. See the RNAlib documentation for details on the file format. The placeholder file name ’DNA’ can be used to load DNA parameters without the need to actually specify any input file.
−4, −−noTetra
Do not include special tabulated stabilizing energies for tri−, tetra− and hexaloop hairpins.
(default=off)
Mostly for testing.
−−salt=DOUBLE
Set salt concentration in molar (M). Default is 1.021M.
−−saltInit=DOUBLE
Provide salt correction for duplex initialization (in kcal/mol).
Model Details:
Tweak the energy model and pairing rules additionally using the following parameters
−d, −−dangles=INT
Specify "dangling end" model for bases adjacent to helices in free ends and multi−loops.
(default=‘2’)
With −d2 dangling energies will be added for the bases adjacent to a helix on both sides in any case.
The option −d0 ignores dangling ends altogether (mostly for debugging).
−−noLP |
Produce structures without lonely pairs (helices of length 1). |
(default=off)
For partition function folding this only disallows pairs that can only occur isolated. Other pairs may still occasionally occur as helices of length 1.
−−noGU |
Do not allow GU pairs. |
(default=off)
−−noClosingGU
Do not allow GU pairs at the end of helices.
(default=off)
−−nsp=STRING
Allow other pairs in addition to the usual AU,GC,and GU pairs.
Its argument is a comma separated list of additionally allowed pairs. If the first character is a "−" then AB will imply that AB and BA are allowed pairs, e.g. −−nsp="−GA" will allow GA and AG pairs. Nonstandard pairs are given 0 stacking energy.
−−energyModel=INT
Set energy model.
Rarely used option to fold sequences from the artificial ABCD... alphabet, where A pairs B, C−D etc. Use the energy parameters for GC (−−energyModel 1) or AU (−−energyModel 2) pairs.
−−helical−rise=FLOAT
Set the helical rise of the helix in units of Angstrom.
(default=‘2.8’)
Use with caution! This value will be re−set automatically to 3.4 in case DNA parameters are loaded via −P DNA and no further value is provided.
−−backbone−length=FLOAT
Set the average backbone length for looped regions in units of Angstrom.
(default=‘6.0’)
Use with caution! This value will be re−set automatically to 6.76 in case DNA parameters are loaded via −P DNA and no further value is provided.
REFERENCES
If you use this program in your work you might want to cite:
R. Lorenz, S.H. Bernhart, C. Hoener zu Siederdissen, H. Tafer, C. Flamm, P.F. Stadler and I.L. Hofacker (2011), "ViennaRNA Package 2.0", Algorithms for Molecular Biology: 6:26
I.L. Hofacker, W. Fontana, P.F. Stadler, S. Bonhoeffer, M. Tacker, P. Schuster (1994), "Fast Folding and Comparison of RNA Secondary Structures", Monatshefte f. Chemie: 125, pp 167-188
R. Lorenz, I.L. Hofacker, P.F. Stadler (2016), "RNA folding with hard and soft constraints", Algorithms for Molecular Biology 11:1 pp 1-13
U. Mueckstein, H. Tafer, J. Hackermueller, S.H. Bernhart, P.F. Stadler, and I.L. Hofacker (2006), "Thermodynamics of RNA-RNA Binding", Bioinformatics: 22(10), pp 1177-1182
The energy parameters are taken from:
D.H. Mathews, M.D. Disney, D. Matthew, J.L. Childs, S.J. Schroeder, J. Susan, M. Zuker, D.H. Turner (2004), "Incorporating chemical modification constraints into a dynamic programming algorithm for prediction of RNA secondary structure", Proc. Natl. Acad. Sci. USA: 101, pp 7287-7292
D.H Turner, D.H. Mathews (2009), "NNDB: The nearest neighbor parameter database for predicting stability of nucleic acid secondary structure", Nucleic Acids Research: 38, pp 280-282
EXAMPLES
Output to stdout:
In Interaction mode RNAup prints the most favorable interaction energy between the two sequences to stdout. The most favorable interaction energy (dG) depends on the position in the longer sequence (region [i,j]) and the position in the shorter sequence (region[k,l]): dG[i,j;k,l]. dG[i,j;k,l] is the largest contribution to dG[i,j] = sum_kl dG[i,j;k,l] which is given in the output file: therefore dG[i,j;k,l] <= dG[i,j].
’....,....1....,....2....,....3....,....4....,....5....,....6....,....7....,....8’
> franz
GGAGUAGGUUAUCCUCUGUU
> sissi
AGGACAACCU
dG = dGint + dGu_l
(((((.((((&)))).))))) 6,15 : 1,10 (-6.66 = -9.89 + 3.23)
AGGUUAUCCU&AGGACAACCU
RNAup output in file: franz_sissi_w25_u3_4_up.out
where the result line contains following information
RNAduplex
results [i,j] [k,l] dG = dGint + dGu_l
(((((.((((&)))).))))) 6,15 : 1,10 (-6.66=-9.89+3.23)
Output to file:
Output to file contains a header including date, the command line of the call to RNAup, length and names of the input sequence(s) followed by the sequence(s). The first sequence is the target sequence. Printing of the header can be turned off using the -nh option.
The line directly after the header gives the column names for the output:
position dGu_l
for -u 3 dGu_l for -u 4 dG
# pos u3S u3H u4S u4H dG
where all information refers to the target sequence. The dGu_l column contains information about the -u value (u=3 or u=4) and the contribution to the free energy to open all structures "S" or only hairpin loops "H", see option -c. NA means that no results is possible (e.g. column u3S row 2: no region of length 3 ending at position 2 exists).
# Thu Apr 10
09:15:11 2008
# RNAup -u 3,4 -c SH -b
# 20 franz
# GGAGUAGGUUAUCCUCUGUU
# 10 sissi
# AGGACAACCU
# pos u3S u3H u4S u4H dG
1 NA NA NA NA -1.540
2 NA NA NA NA -1.540
3 1.371 NA NA NA -1.217
4 1.754 5.777 1.761 NA -1.393
5 1.664 3.140 1.811 5.800 -1.393
If the -b option is selected position and dGu_s values for the shorter sequence are written after the information for the target sequence.
AUTHOR
Ivo L Hofacker, Peter F Stadler, Ulrike Mueckstein, Ronny Lorenz
REPORTING BUGS
If in doubt our program is right, nature is at fault. Comments should be sent to rna@tbi.univie.ac.at.