Font size: Increase font size Decrease font size Switch style sheet from default to highcontrast and back

Changelog

Version 2.4.x

2.4.1
  • Programs

    • Regression: Fix homo-dimer partition function computation in RNAcofold
    • Add SHAPE reactivity support to RNAcofold
    • Add SHAPE reactivity support to RNALalifold

  • Library

    • Regression: Fix reverting pf_scale to defaults after vrna_exp_params_rescale()
    • Fix memory leak in SWIG generated fold_compound methods returning dot-bracket strings
    • Fix memory leaks in double ** returning functions of SWIG Perl5 interface
    • Fix memory leak in vrna_ep_t.__str__() function of SWIG interface

  • Package

    • Add unit tests for RNAcofold executable

2.4.0

This version adds hard/soft constraints support for our implementations of sliding-window structure prediction as used in the executable programs RNALfold and RNAplfold.

Together with the new feature of hard- and soft-constraints for sliding-window structure prediction we unified and corrected the implementations used in the tools RNALfold, RNALalifold, and RNAplfold.

The major changes are

  • All the above tools now use the same definition of maximum base pair span.
    This means that for a maximum base pair span of L the recursions only consider base pairs (i, j) with (j - i + 1) ≤ L.
  • Locally optimal structures that are part of another, larger locally optimal structure are filtered out.
    This mainly affects the output of RNALfold that sometimes did not filter properly. Note, however, that filtering is only performed for consecutive hits!. Thus, it may still happen that locally optimal substructures appear in the output.
  • Locally optimal structure must not be branched in the exterior loop.
    This rule was not considered in the output of RNALalifold and thus has a large impact on the hits obtained from that tool.

Therefore, comparing the output of the above tools against that of version 2.3.5 or less will most likely result in differences.

This version also adds a new software sub-package, RNAlocmin. Detailed information on this tool can be obtained here. Additionally, we also add a PDF version of the RNA Bioinformatics tutorial as available on our homepage to the default instalation target.

The list of all major changes in this version can be found below:

  • Programs

    • Print G-Quadruplex corrections in verbose mode of RNAeval
    • Change behavior of RNAfold --outfile option to something more predictable
    • Unify max_bp_span usage among sliding window prediction algorithms: RNAplfold, RNALfold, and RNALalifold now consider any base pair (i,j) with (j - i + 1) <= max_bp_span
    • Add SHAPE reactivity data support to RNALfold
    • Add commands-file support for RNALfold, RNAplfold (hard/soft constraints)
    • Fix regression for --canonicalBPonly switch in RNAfold/RNAcofold/RNAsubopt
    • Fix Alidot link in RNAalifold manpage
    • Restore capability to compile stand-alone findpath utility

  • Library

    • Add hard constraints to sliding-window MFE and PF implementations
    • Add soft constraints to sliding-window MFE and PF implementation for single sequences
    • Add SWIG interfaces for sliding-window MFE/PF implementations
    • Add proper SWIG interface for alignment and structure plotting functions
    • Add proper SWIG interface for duplexfold, duplex_subopt, and its comparative variants
    • Add SWIG wrapper for vrna_exp_params_rescale()
    • Add explicit destructor for SWIG generated vrna_md_t objects
    • Add SWIG perl5 typemap for simple nested STL vectors
    • Add dummy field in vrna_structured_domains_s
    • Add SWIG interface for findpath implementation
    • Add prepare() functions for ptype-arrays and vrna_(exp_)param_t
    • Add warnings for ignored commands in function vrna_commands_apply()
    • Add callback featured functions for sliding window MFE and PF implementations
    • Change default behavior of adding soft constraints to a vrna_fold_compound_t (store only)
    • Several fixes with respect to G-Quadruplex prediction in sliding-window MFE recursions (single sequence and comparative implementation)
    • Replace comparative sliding-window MFE recursions (All hits are reported to callback and can be filtered in a post-processing step)
    • API: Remove E_mb_loop_stack() and introduce new function vrna_E_mb_loop_stack() as a replacement
    • API: change data type of all constraint bit-flags from char to unsigned char
    • API: change data type of a2s array in comparative structure prediction from unsigned short to unsigned int
    • API: Change function parameter order in vrna_probs_window() to follow the style of other callback-aware functions in RNAlib
    • Move sliding-window MFE implementations to new file mfe_window.c
    • Fix redefinition of macro ON_SAME_STRAND() in subopt.c
    • Fix dangling end issues in sliding-window MFE implementations
    • Fix building sliding-window MFE implementation without SVM support
    • Fix parsing of STOCKHOLM 1.0 MSA files that contain MSA spanning multiple blocks
    • Fix buffer overflow in hairpin loop sequence motif extraction for circular RNAs
    • Fix out-of-bounds memory access in neighbor.c
    • Restore capability to use non-standard alphabets for structure prediction
    • Restore old-API random number functions in SWIG interface
    • Allow additional control characters in MAF MSA input that do not end a block
    • Make functions in pair_mat.h static inline
    • Prevent users from adding out-of-range base pair soft constraints
    • Inline print functions in color_output.inc
    • Introduce state flag in vrna_sc_s

  • Package

    • Bump libsvm to version 3.22
    • Add RNAlocmin - Calculate local minima from structures via gradient walks
    • Add RNA Bioinformatics tutorial (PDF version)
    • Add note about SSE optimized code in reference manual
    • Fix building PDF Reference manual with non-standard executable paths
    • Fix wrong pre-processor flags when enabling single-precision PF computations
    • Fix unit testing perl5 interface by including builddir/tests in PERL5LIB path
    • General improvements in reference manual
    • Remove obsolete scripts ct2b.pl and colorrna.pl from src/Utils directory
    • Remove old RNAfold tutorial

Version 2.3.x

2.3.5
  • Programs

    • Fix duplication of output filename prefix in RNAfold
    • Add G-Quadruplex prediction to RNALalifold
    • Enable users to turn-off base pair probability computations in RNAcofold with -a option

  • Library

    • Add V3.0 API for sliding window partition function (a.k.a. RNAPLfold)
    • Add SWIG wrappers for callback-based sliding window comparative MFE prediction
    • Add SSE4.1 multiloop decomposition for single sequence MFE prediction (Thanks to W. B. Langdon)
    • Split move set in neighbor.c

  • Package

    • Enable RNAfold unit tests to run in paralllel

2.3.4
  • Programs

    • Fix double-free when using SHAPE reactivity data in RNAalifold
    • Fix z-score output in RNALfold
    • Enhance auto-id feature in executable programs
    • Always sanitize output file names to avoid problems due to strange FASTA headers
    • Lift restrictions of FASTA header length in RNAfold, RNAcofold, and RNAeval
    • Add test-suite for RNAfold
    • Enable RNALalifold to read Clustal/Stockholm/FASTA/MAF alignments in batch-mode
    • Add parameter option to RNALalifold for colored EPS alignment and structure plot output
    • Add parameter option to RNALalifold to write hits into Stockholm file
    • Add parameter option to RNAalifold to write Stockholm 1.0 formatted output
    • Add parameter option to RNAalifold to suppress stderr spam
    • Add auto-id feature to RNAplot, RNALfold, RNAsubopt, RNAplfold, RNAheat
    • Add SHAPE reactivity derived pseudo-energies as separate output in RNAalifold
    • Add colored terminal output to RNA2Dfold, RNALalifold, RNALfold, RNAduplex, RNAheat, RNAinverse, RNAplfold, and RNAsubopt
    • Add command line parameters to RNAsubopt to allow for specification of input/output files

  • Library

    • Fix G-Quadruplex global probability computation for single sequences
    • Fix out-of-bounds access in strand_number array
    • Implement sane weighting of SHAPE reactivity data in consensus structure prediction when fewer data than sequences are present
    • Substitute field name A0,B0 in data structure vrna_dimer_conc_s by Ac_start,Bc_start to avoid clashes with termios.h (Mac OSX Python wrapper bug)
    • Add ViennaRNA/config.h with pre-processor definitions of configure time choices
    • Add functions to procude colored EPS structure alignments
    • Add function to write Stockholm 1.0 formatted alignments
    • Add function to sanitize file names
    • Add callback based implementation for sliding-window MFE prediction (single sequences, comparative structure prediction)
    • Add fast API 3.0 implementations to generate structural neighbors and perform steepest descent / random walks

  • Package

    • Minimize usage of 'unsafe' sprintf() calls

2.3.3
  • Library

    • Fix bug in multiloop contributions for comparative partition function

  • Package

    • Fix building python2 extension module for OSX

2.3.2
  • Programs

    • Fix behavior of RNAplfold for unusually short RNAs
    • Report SCI of 0 in RNAalifold when sum of single sequence MFEs is 0

  • Library

    • Fix pair probability plist creation with G-Quadruplexes
    • Fix init of vrna_md_t data structure after call to set_model_details()
    • Fix bug in consensus partition function with hard constraints that force nucleotides to be paired
    • Enable generic hard constraints by default
    • Fix init of partition function DP matrices for unusually short RNAs
    • Prevent multiple includes of pair_mat.h

  • Package

    • Allow for specification of python2/3-config at configure time
    • Fix compilation of functions that use ellipsis/va_list
    • Add configure flag to build entirely static executables

2.3.1
  • Programs

    • Add unstructured domain feature example to RNAfold manpage

  • Library

    • Fix regression in vrna_md_update() that resulted in incomplete init of reverse-basepair type array (mainly affectingRNAalifold)
    • Fix scaling of secondary structure in EPS plot such that it always fits into bounding box
    • Several fixes and improvements for SWIG generated scripting language interface(s)
    • Extend coverage of generic hard constraints for partition function computations
    • Add missing newline in non-TTY-color output of vrna_message_info()
    • Add description for how to use unstructured domains through command files to reference manual

  • Package

    • Fix compilation issue for Windows platforms with MingW

2.3.0

This version introduces the first transitions towards a more flexible, callback-function based RNA secondary structure decomposition.

The so-called unstructured domains feature extends the RNA folding grammar with alternative handling of self-enclosed unpaired stretches in an RNA structure. This enables one, for instance, to model protein binding to single stranded sequence motifs, while addressing the competition between base pairing and binding affinity of the ligand. The entire extension is not only available using our RNAlib C-library, but also through the Perl and Python scripting interfaces. The program RNAfold already includes a convenience method to add unstructured domain sequence motifs and their corresponding binding free energy through easy-to-use command files.

For further details, we refer to our publication "RNA folding with hard and soft constraints", the section on Unstructured Domains and Domain extensions commands of the RNAlib reference manual, and the manpage of RNAfold.

  • Programs

    • Introduced command files that subsume constraint definition files (RNAfold and RNAcofold)
    • Replace explicit calls to (non-portable) asprintf() with portable equivalent functions in the library
    • Fix regression that prevented several programs to fail on too long input sequences
    • Extend EPS dot-plot in RNAfold to include motif/binding probabilities from unstructured domains
    • Add ID manipulation feature to RNAeval

  • Library

    • Introduce grammar extension through structured and unstructured domains
    • Add unstructured domains feature in MFE, partition function, and equilibrium probability computations for single RNA sequences
    • Add default implementation for unstructured domains to allow for ligand/protein binding to unpaired structure segments (MFE and PF for single sequences)
    • Added utility functions that deal with conversion between different units
    • Bugfix in SWIG wrapped generic soft constraint feature
    • Add subopt() and subopt_zuker() methods to SWIG wrapped fold_compound objects
    • Fix multiloop decomposition in MFE for circular RNAs
    • Add separate function to compute pscore for alignments
    • Renamed VRNA_VC_TYPE_* macros to VRNA_FC_TYPE_*
    • Add variadic functions for error/warning/info message
    • Extend API for soft constraint feature for more fine-grained control
    • Fix bug in interior loop computations when hard constraints result in non-canonical base pairs
    • Restructured reference manual
    • Add section on SWIG wrapped functions in reference manual

  • Package

    • Fix configure script to deal with situations where Perl module can't be build
    • Fix bug in doc/Makefile.am that prevented HTML installation due to long argument list

Version 2.2.x

2.2.10
  • Programs

    • Fix bad memory access that occasionally occured in RNAsubopt with sorted output

  • Library

    • Fix bad memory access in vrna_subopt() with sorted output
    • Do not 'forget' subopt results when output is not written to file handle and sorting is switched off
    • Add SWIG wrappers for vrna_subopt_cb()

  • Package

    • Correctly show if C11 features are activated in configure status
    • Fix autoconf checks to allow for cross compilation again

2.2.9
  • Programs

    • Add various new commandline options to manipulate sequence/alignment IDs in RNAfold, RNAcofold and RNAalifold
    • Fix bug for temperature setting in RNAplfold
    • Enable RNAalifold to use Clustal, Stockholm, FASTA, or MAF alignments as input
    • Lift restriction of sequence number in alignments for RNAalifold
    • Enable ANSI colors for TTY output in RNAfold, RNAcofold, RNAalifold, RNAsubopt

  • Library

    • Fix bug in hard constraints usage of exterior loop MFE prediction with odd dangles
    • Fix order of hard constraints when read from input file
    • Fix several hard constraint corner-cases in MFE and partition function computation when nucleotides must not be unpaired
    • Fix bug in partition function scaling for backward compatibility of ali_pf_fold()
    • Fix interpretation of 'P' hard constraint for single nucleotides in constraint definition files
    • Add 'A' command for hard constraints in hard constraints definition files
    • Stabilize v3.0 API when building RNAlib and third party program linking against it with compilers that use different C/C++ standards
    • Use -fflat-lto-objects for static RNAlib library to allow linking without LTO
    • Add parsers for Clustal, Stockholm, FASTA, and MAF formatted alignment files
    • Allow for non-canonical base pairs in MFE and partition function computations if hard constraints demand it
    • Enable ANSI colors for TTY output for warnings/errors issued by RNAlib

  • Package

    • Add details on how to link against RNAlib to the reference manual

2.2.8
  • Programs

    • Fix bad memory access in RNAalifold
    • Fix regression in RNAalifold to restore covariance contribution ratio determination for circular RNA alignments
    • Changed output of RNAsubopt in energy-band enumeration mode to print MFE and energy range in kcal/mol instead of 10cal/mol
    • Include latest Kinfold sources that make use of v3.0 API, therefore speeding up runtime substantially
    • Re-activate warnings in RNAeval when non-canonical base pairs are encountered

  • Library

    • Fix syntactic incompatibilities that potentially prevented compilation with compilers other than gcc
    • Add function to compare nucleotides encoded in IUPAC format
    • Fix regression in energy evaluation for circular RNA sequences
    • Fix regression in suboptimal structure enumeration for circular RNAs
    • Allow for P i-j k-l commands in constraint definition files
    • Make free energy evaluation functions polymorphic
    • Add free energy evaluation functions that allow for specifying verbosity level
    • Secure functions in alphabet.c against NULL pointer arguments
    • Fix incompatibility with swig ≥ 3.0.9
    • Fix memory leak in swig-generated scripting language interface(s) for user-provided target language soft-constraint callbacks
    • Expose additional functions to swig-generated scripting language interface(s)
    • Build Python3 interface by default
    • Start of more comprehensive scripting language interface documentation
    • Fix linking of python2/python3 interfaces when libpython is in non-standard directory

  • Package

    • Restructured viennarna.spec for RPM based distributions
    • Several syntactic changes in the implementation to minimize compiler warnings
    • Fix --with-*/--without-* and --enable-*/--disable-* configure script behavior

2.2.7
  • Programs

    • Fix partition function scaling for long sequences in RNAfold, RNAalifold, and RNAup
    • Fix backtracking issue in RNAcofold when --noLP option is activated

  • Library

    • Fix hard constraints issue for circular RNAs in generating suboptimal structures

  • Package

    • Rebuild reference manual only when actually required

2.2.6
  • Programs

    • Plugged memory leak in RNAcofold
    • Fixed partition function rescaling bug in RNAup
    • Fixed bug in RNALfold with window sizes larger than sequence length
    • Re-added SCI parameter for RNAalifold
    • Fixed backtracking issue for large G-quadruplexes in RNAalifold
    • Fixed missing FASTA id in RNAeval output
    • Added option to RNAalifold that allows to specify prefix for output files

  • Library

    • Several fixes and additional functions/methods in scripting language interface(s)
    • Added version information for scripting language interface(s)
    • Some changes to allow for compilation with newer compilers, such as gcc 6.1

2.2.5
  • Programs

    • Fixed regression in RNAcofold that prohibited output of concentration computations
    • Fixed behavior of RNAfold and RNAcofold when hard constraints create empty solution set (programs now abort with error message)

  • Library

    • Added optional Python 3 interface
    • Added RNA::Params Perl 5 sub-package
    • Update RNA::Design Perl 5 sub-package
    • Simplified usage of v3.0 API with default options
    • Wrap more functions of v3.0 API in SWIG generated scripting language interfaces
    • Plugged some memory leaks in SWIG generated scripting language interfaces
    • Changed parameters of recursion status callback in vrna_fold_compound_t
    • Enable definition and binding of callback functions from within SWIG target language

  • Package

    • Added optional subpackage Kinwalker
    • Added several configure options to ease building and packaging under MacOS X
    • Added new utility script RNAdesign.pl

2.2.4
  • Programs

    • Fixed bug in RNAsubopt that occasionally produced cofolded structures twice

  • Library

    • Removed debugging output in preparations of consensus structure prediction datastructures

2.2.3
  • Programs

    • Added postscipt annotations for found ligand motifs in RNAfold
    • Added more documentation for the constraints features in RNAfold and RNAalifold

  • Library

    • Restore backward compatibility of get_alipf_arrays()

2.2.2
  • Programs

    • Fix regression bug that occasionally prevented backtracking with RNAcofold --noLP

2.2.1
  • Programs

    • Fix regression bug that made RNAcofold -a unusable
    • Fix regression bug that prohibited RNAfold to compute the MEA structure when G-Quadruplex support was switched on
    • Fix bug in Kinfold to enable loading energy parameters from file
    • Fix potential use of uninitialized value in RNApdist
    • Add manpage for ct2db

  • Library

    • Fix MEA computation when G-Quadruplex support is activated

  • Package

    • Allow for vendor installation of the perl interface using INSTALLDIRS=vendor at configure time
    • Install architecture dependent and independent files of the perl and python interface to their correct file system locations

2.2.0

This version introduces tons of new features. First of all, the new hard- and soft-constraints allow for easy manipulation of the prediction recursions. For instance, SHAPE reactivity data can be directly converted to soft-constraints and readily used in MFE, and partition function computations. Ligand binding to hairpins and interior loops with specific sequence/structure motifs, e.g. accessible through RNAfold, is another feature that became possible due to the new constraints framework.

Most of the new features we've implemented into RNAlib require specific new functions that, partially, replace already existing ones. Therefore, with this version, we start introducing the new v3.0 API, that will eventually replace the one currently existing. All functions of the new API are now prefixed with vrna_ that not only makes them easily recognizable, but also provides some sort of namespacing that helps in the development of third-party programs linking agains RNAlib.
Through usage of a generic data structure for all secondary structure prediction algorithms, most functions that implement a special algorithm, such as MFE, or partition function, are now polymorphic. Thus, there is only one single function in the interface that can deal with multiple variations of input, such as single sequences or sequence alignments.
However, we will maintain complete backward compatibility until v3 of the ViennaRNA Package.

We also started to make the new API accessible through the Perl and Python interface, where we introduce a new object-oriented way to use the RNAlib.

Please see the RNAlib Reference Manual, and the individual manpages of the executable programs in the ViennaRNA Package for further details on new features, and feature changes.

  • Programs

    • RNAforester is now of version 2.0
    • New program RNApvmin to compute pseudo-energy pertubation vector that minimizes discrepancy between observed and predicted pairing probabilities
    • SHAPE reactivity support for RNAfold, RNAsubopt, and RNAalifold
    • Ligand binding to hairpin- and interior-loop motif support in RNAfold
    • New commandline option to limit maximum base pair span for RNAfold, RNAsubopt, RNAcofold, and RNAalifold
    • Bugfix in RNAheat to remove numerical instabilities
    • Bugfix in RNAplex to allow for computation of interactions without length limitation
    • Bugfix in RNAplot for simple layouts and hairpins of size 0

  • Library

    • (generic) hard- and soft-constraints for MFE, partition function, base pair probabilities, stochastic backtracking, and suboptimal secondary structures of single sequences, sequence alignments, and sequence dimers
    • libsvm version as required for z-scoring in RNALfold is now 3.20
    • Stochastic backtracking for single sequences is faster due to usage of Boustrophedon scheme
    • First polymorphic functions vrna_mfe(), vrna_pf(), and vrna_pbacktrack().
    • The FLT_OR_DBL macro is now a typedef
    • New functions to convert between different secondary structure representations, such as helix lists, and RNAshapes abstractions
    • First object-oriented interface for new API functions in the scripting language interfaces
    • new ViennaRNA-perl submodule that augments the Perl interface to RNAlib
    • Ligand binding to hairpin- and interior-loop motif support in C-library and scripting language interfaces.

  • Package

    • Libraries are generated using libtool
    • Linking of libraries and executables defaults to use Link Time Optimization (LTO)
    • Large changes in directory structure of the source code files

Version 2.1.x

2.1.9

This version fixes a major bug in the energy evaluation of exterior loops and multibranch loops!

In previous versions of the ViennaRNA Package starting with version 2.0, the energy contributions for dangling ends and terminal mismatches of exterior- and multibranch loops were not applied correctly. This problem appeared due to a defective parser that converts the Turner 2004 energy parameters into ViennaRNA code. Therefore, if you compare predictions, e.g. from RNAfold 2.1.9, with those of versions prior to 2.1.9, they may differ. In general, the differences in predicted structures and energies should be very small. However, it may happen that results are totally different.

To assess the impact of the fixed energy parameter usage we re-ran all benchmarks as applied for the original publication of The ViennaRNA Package 2.0. The resulting performance measures suggest, that the impact is actually very small, although predictions seem to be slightly better with version 2.1.9.
See the ViennaRNA Package 2.0 - Performance page for details.

  • Programs

    • Fixed integer underflow bug in RNALfold
    • Added Sequence Conservation index (SCI) option to RNAalifold

  • Library

    • Fixed bug in energy evaluation of dangling ends / terminal mismatches of exterior loops and multibranch loops
    • Fixed bug in alifold partition function for circular RNAs
    • Fixed bug in alifold that scrambled backtracing with activated G-Quadruplex support
    • Fixed bug in alifold backtracking for larger G-Quadruplexes

  • Utils

    • Avoid warning for missing sequence constraint in switch.pl

2.1.8
  • Programs

    • Repaired incorporation of RNAinverse user provided alphabet
    • Fix missing FASTA ID in RNAeval output

  • Library

    • prevent race condition in parallel calls of Lfold()
    • Fixed memory bug in Lfold() that occured using long sequences and activated G-Quad support

  • Utils

    • Added latest version of switch.pl

2.1.7
  • Programs

    • Fixed bug in RNALfold -z

  • Library

    • Python and Perl interface are compiling again under MacOSX. See Install Notes.
    • Fixed handling of C arrays in Python interface

  • Utils

    • Added latest version of switch.pl
    • Make relplot.pl work with RNAcofold output

2.1.6
  • Programs

    • New commandline switches allow for elimination of non-canonical base pairs from constraint structures in RNAfold, RNAalifold and RNAsubopt

  • Library

    • updated moveset functions
    • final fix for discrepancy of tri-loop evaluation between partition function and mfe
    • pkg-config file now includes the OpenMP linker flag if necessary

  • Utils

    • New program ct2db allows for conversion of .ct files into dot-bracket notation (incl. pseudo-knot removal)

2.1.5
  • Library

    • Fix for discrepancy between special hairpin loop evaluation in partition functions and MFE

2.1.4
  • Library

    • Fix of G-quadruplex support in subopt()
    • Fix for discrepancy between special hairpin loop evaluation in partition functions and MFE

2.1.3
  • Programs

    • RNAfold: Bugfix for ignoring user specified energy parameter files
    • RNAcofold: Bugfix for crashing upon constrained folding without specifying a constraint structure
    • RNAsubopt: Added G-quadruplex support
    • RNAalifold: Added parameter option to specify base pair probability threshold in dotplot

  • Library

    • Fix of several G-quadruplex related bugs
    • Added G-quadruplex support in subopt()

2.1.2
  • Programs

    • RNAfold: Bugfix for randomly missing probabilities in dot-plot during batch job execution
    • RNAeval: Bugfix for misinterpreted G-quadruplex containing sequences where the quadruplex starts at nucleotide 1
    • RNAsubopt: Slight changes to the output of stochastic backtracking and zuker subopt

  • Library

    • Fix of some memory leaks
    • Bugfixes in zukersubopt(), assign_plist_from_pr()
    • New threadsafe variants of putoutpU_prob*() for LPfold()
    • Provision of python2 interface support. This interface is very basic at the moment and the configure script default is to disable it. If you want to try it out, use it at your own risk. Comments and remarks about usability are welcome.

2.1.1
  • Library

    • Bugfix to restore backward compatibility with ViennaRNA Package 1.8.x API (this bug also affected proper usage of the the perl interface)

2.1.0

The ViennaRNA Package was recently extended to take a certain class of higher-order structure motifs, so called G-quadruplexes, into account, too.

This is the recursion scheme that we use to predict these structure motifs:

G-quadruplex predictions are marked by the character "+" in the extended dot-parenthesis notation output. Thus, RNAfold output may look like

$ echo "GGCUGGUGAUUGGAAGGGAGGGAGGUGGCCAGCC" | Progs/RNAfold -g
GGCUGGUGAUUGGAAGGGAGGGAGGUGGCCAGCC
((((((..........++.++..++.++)))))) (-21.39)

Here, the four consecutive stretches of "+" mark the G-G interactions within the G-quadruplex. On calculation of base pairing probabilities, the dot-plot output of RNAfold contains the Boltzmann probabilities of a G-quadruplex delimited by sequence position i and j, depicted by a green triangle, as well as the individual G-G interaction probabilities displayed like canonical base pair interactions.
Calculation of the base pair probabilities for the above example then results in a dot-plot like this

References for this new feature:
"RNA Folding Algorithms with G-Quadruplexes" - Ronny Lorenz, Stephan H. Bernhart, Fabian Externbrink, Jing Qin, Christian Höner zu Siederdissen, Fabian Amman, Ivo L. Hofacker and Peter F. Stadler, Advances in Bioinformatics and Computational Biology, Lecture Notes in Computer Science, 7409, (2012) page(s) 49-60, Publisher: Springer Berlin / Heidelberg, Editor(s): Marcilio de Souto and Maricel Kann
  • Programs

    • G-Quadruplex support in RNAfold, RNAcofold, RNALfold, RNAalifold, RNAeval and RNAplot
      This introduces a new commandline option '--gquad/-g' that enables G-quadruplex prediction. The dot-bracket notation for the structure output now contains an additional character '+' that indicates the presence of such a G-tetrad. Consecutive '+' signs always come in sets of 4 interspaced by some '.', marking the four G-runs and its linker sequences that comprise the quadruplex, respectively.
    • changes in RNAPKplex behavior and commandline options
    • new features and bugfixes in RNAplex and RNAsnoop
    • warning messages for all programs if an unsupported dangle option is selected

  • Library

    • LPfold got a new option to output its computations in split-mode
    • several G-Quadruplex related functions were introduced with this release
    • several functions for moves in an RNA landscape were introduced
    • new function in alipfold.c now enables access to the partition function matrices of alipf_fold()
    • different numeric approach was implement for concentration dependend co-folding to avoid instabilities which occured under certain circumstances

  • Utils

    • To enable fast plotting of RNA2Dfold output we now also provide two gri-scripts "2Dlandscape_mfe.gri" and "2Dlandscape_pf.gri".
      To use them, simply redirect the output of RNA2Dfold into a text file and then call the appropriate script with the RNA2Dfold output filename as first parameter, e.g.:

      $ ./2Dlandscape_mfe.gri my_2Dfold_output.txt

      This will create a postscript file named "my_2Dfold_output.txt.ps" that displays the MFE output in a nice landscape like manner
    • The Utils script "relplot.pl" got a new commandline option "-a" that enables annotation of the accessibility in the structure plot

  • Package

    • The auxilary energy parameter files in the source tree now reside in the 'misc' directory.
      They are, however, still installed at the same locations as in previous versions of the Package.
    • Some changes in the build process now enable easier cross compilation of the Package
    • The example sourcecode in the reference manual got an update to comply with the specifications of ViennaRNA Package 2.x

Version 2.0.x

2.0.7
  • Programs

    • Bugfix for RNAplfold where segfault happened upon usage of -O option
    • Corrected misbehavior of RNAeval and RNAplot in tty mode

2.0.6
  • Programs

    • Bugfix for bad type casting with gcc under MacOSX (resulted in accidental "sequence too long" errors)
    • Bugfix for disappearing tri-/hexaloop contributions when read in from certain parameter files
    • Bugfix for RNALfold that segfaulted on short strange sequences like AT+ repeats
    • Change of RNA2Dfold output format for stochastic backtracking

2.0.5
  • Programs

    • Restored z-score computation capabilities in RNALfold

2.0.4
  • Programs

    • Bugfix for RNAcofold partition function

  • Library

    • Perl wrapper compatibility to changed RNAlib has been restored
    • Backward compatibility for partition function calls has been restored [under certain circumstances under-/overflows in the calculations of pf_fold(), alipf_fold(), co_pf_cold() and pfl_fold() appeared in version 2.0.3]

2.0.3
  • Programs

    • Bugfix for RNAalifold partition function and base pair probabilities in v2.0.3b
    • Added Boltzmann factor scaling in RNAsubopt, RNAalifold, RNAplfold and RNAcofold

  • Library

    • Bugfix for alipfold() in v2.0.3b
    • Restored threadsafety of folding matrix access in LPfold.c, alipfold.c, part_func.c, part_func_co.c and part_func_up.c
    • Added several new functions regarding threadsafe function calls in terms of concurrently changing the model details. The new functions with the suffix '_par' may now be used to pass an energy contribution datastructure filled with additional information about the model details. In this way, seperation from the global variables

      dangles, noLonelyPairs, noGU, no_closingGU, tetra_loop, temperature, logML

      is possible. Furthermore, the new functions also provide detachement from the global variables

      do_backtrack, fold_constrained

      This works for all implementations in
      • fold.c
      • part_func.c
      • LPfold.c
      • alipfold.c

      Basic support is provided in
      • cofold.c
      • part_func_co.c
      • subopt.c

      However, since all cofolding functions currently rely on the global variable 'cut_point', they are not considered really threadsafe yet, i.e. a change in the cut_point while concurrent calculations take place will result in unpredictable results!

      Threadsafety of the remaining functions, regarding the above mentioned global variables will be incoorporated in upcoming versions

      See the reference manual of the RNAlib for more details (params.h, part_func.h, etc.)

  • Package

    • Added pkg-config file in the distribution to allow easy checks for certain RNAlib2 versions, compiler flags and linker flags. This makes linking of third party programs agains RNAlib2 much more easier.
      E.g. a call of 'pkg-config --modversion RNAlib2' reveals the version of the installed RNAlib. Developers who use autoconf may now take advantage of the different PKG_ macros to retrieve version, linker and compiler flags

2.0.2
  • Programs

    • added support for Boltzmann factor scaling in RNAfold
    • fixed fastaheader to filename bug

  • Library

    • plugged some memory leaks

2.0.1
  • Package

    • First official release of version 2.0
    • included latest bugfixes

History

  • 09.05.2011

    Fixed file name issue that occured under HFS on MacOS X (unbelievably HFS is not capable to distinguish files solely based on the case of the letters in the filename)

  • 18.04.2011

    Fixed RNAcofold bug (memory corruption when two complementary sequences form a full length helix)

  • 17.03.2011

    Fixed RNAsubopt bug (invalid free() appeared sometimes depending on compiler used)

  • 10.03.2011

    Replaced calls to non-ANSI function strndup() to ensure compatibility with MacOS X and FreeBSD

  • 07.03.2011

    Fixed RNAup bug (interaction mode might have taken wrong sequence as target in batch mode)