Font size: Increase font size Decrease font size Switch style sheet from default to highcontrast and back

Changelog

Version 2.7.x

2.7.1
  • Programs

    • Allow for FASTA header changes in ct2db
    • Fix constraints parsing in RNAsubopt
    • Add new command line options for structure probing data to RNAfold and RNAsubopt

  • Library

    • API: Refactor structure probing data API to support multiple data at once, position-wise weighting, user-defined reactivity-to-energy strategies and more
    • API: Refactor hard constraint wrappers
    • API: Add ViennaRNA/math/ to provide several useful mathematical functions
    • API: Add vrna_str_to_dbl_array()
    • API: Add vrna_file_doubles_read()
    • API: Fix backtracking issues in exterior loop
    • API: Fix backtracking issues with odd dangles
    • API: Fix segmentation fault in vrna_pt_pk_remove()
    • API: Fix vrna_plist() and vrna_ptable() to deal with malformed input
    • API: Fix soft constraints access in backtracking of QM2 (Boltzmann sampling)
    • SWIG: Add wrappers for concentration dependency computations
    • SWIG: Fix RNA.fold_compound.bpp() output for multistrand base pair probabilities
    • SWIG: Do not return symmetric pair probability matrix by default
    • SWIG: Fix Python object ownership in callbacks for unstructured domains, direct soft constraints and landscape moves

  • Package

    • Update dlib to version 20.0
    • Overall improvements to the documentation
    • Fix energy parameter file markup
    • Fix compilation with compilers that default to C23
    • Update swig requirement to 4.2.0
    • Fix compilation without libsvm
    • Update breathe to version v5.0.0a5
    • Add probing data priors (paired and unpaired) for 1M7 and DMS

2.7.0

This version adds G-Quadruplex support for circular RNAs, a new and unified experiment RNA structure probing API and an internal log-message system. All new features are exposed either through the command line tools or(and) the API of RNAlib.

For multibranch loop decompositions, our global RNA structure prediction recursions now rely on an M2 (at least two branches within a multiloop) dynamic programming matrix, rather the the M1 DP matrix (exactly one branch within a multiloop) that has been used before. This not only slightly reduces the overall runtime but also unifies the implementations for circular RNAs, global and local RNA structure prediction. Moreover, the API underwent a major clean-up to unify the naming of functions and the data types of their input and output parameters. RNAlib header include files have now been grouped into separate subdirectories to obtain a better structured interface.

With this release we also ship two new sets of energy parameters for modified bases, in particular m5C and N1-methyl-pseudouridine. Both parameter sets have been taken from literature and are derived from in-silico computations. Therefore, we did not hard-wire them into the core library just yet, but only provide the parameter files for manually loading them at runtime.

The user- and developer manuals have been heavily worked on and are available as a unified documentation at ReadTheDocs.

The list of all major changes in this version can be found below:

  • Programs

    • Add hard limit for number of input structures in RNAdistance
    • Add counter example settings to RNAalifold
    • Add covariance annotation legend to RNAplot layout plots for MSA input
    • Add covariance annotation legend to RNALalifold layout plots
    • Adapt structure conservation coloring and add legend in alignment output of RNAplot, RNAalifold, and RNALalifold
    • Add RNAconsensus Python program that will eventually replace refold.pl
    • Add --log-file, --log-level, --log-call and --log-time command line options to executable programs
    • Add --betaScale and --pfScale options to and rescale Boltzmann factors in RNAPKplex
    • Add support for G-Quadruplexes in circular RNAs for RNAfold, RNAalifold, and RNAeval
    • Change RNAplot command line argument -o to -f
    • Add --random-seed option to RNAsubopt and RNAalifold to specify seed for random number generator

  • Library

    • API: Add circular RNA G-Quadruplex support
    • API: Add structure prediction benchmark functions vrna_compare_structure() and vrna_compare_structure_pt()
    • API: Add vrna_annotate_covar_pt() that allows for specifying number of counter examples
    • API: Add structure conservation legend to EPS consensus structure layout plots
    • API: Add vrna_string_make_space_for() and vrna_string_available_space() functions in ViennaRNA/datastructures/string.h
    • API: Add vrna_file_PS_aln_opt() to allow for changing conservation coloring
    • API: Add flexible log message system to avoid spam on stderr and stdout
    • API: Add (generic) compressed sparse row (CSR) matrix implementation
    • API: Add Eddy 2014 approach to incorporate experimental probing data (using Gaussian KDE)
    • API: Add generic support for experimental probing data via new API in ViennaRNA/probing/basic.h
    • API: Add full probing data support for consensus structure prediction
    • API: Add vrna_sc_multi_cb_add_comparative() to allow for multi callback soft constraints in comparative structure predictions
    • API: Add vrna_fold_compound_t to parameters passed to recursion status callback
    • API: Add M2 matrices in favor of M1 for global MFE and partition function computations
    • API: Add safeguard to vrna_array_free()
    • API: Add vrna_pairing_tendency() as replacement for vrna_db_from_probs()
    • API: Group related API symbols and header files into specific subdirectories
    • API: Allow base pair hard constraints via commands file where j = i + 1
    • API: Refactor vrna_pk_plex() accessibility computations
    • API: Refactor backtracking implementations and API, now located under ViennaRNA/backtrack/
    • API: Refactor experimental probing data (SHAPE) implementations, now located under ViennaRNA/probing/
    • API: Refactor auxiliary grammar extension API, now located under ViennaRNA/grammar/
    • API: Refactor G-Quadruplex implementation and fix existing bugs and numerical issues in corresponding energy evaluation
    • API: Refactor verbose vrna_eval*() implementations
    • API: Refactor structure plotting API and add unified structure plotting function vrna_plot_structure()
    • API: Remove exit() calls from RNAlib
    • API: Change behavior and parameter order for vrna_hc_add_bp_strand()
    • API: Change behavior and parameters of vrna_hc_add_up_strand()
    • API: Unify backtracking matrix flags
    • API: Use vrna_array() based base pair and backtrack stacks for MFE implementations
    • API: Introduce entropic penalty for unpaired circular RNAs (may be switched off by model settings circ_penalty flag)
    • API: Deprecate vrna_message_info(), vrna_message_warning(), and vrna_message_error() in favor of new loggin system
    • API: Fix vrna_neighbor_diff*() insertion moves
    • API: Fix MFE inside recursion for multiloop unpaired positions
    • API: Fix vrna_hx_from_ptable() when provided hairpins of length 0
    • API: Fix vrna_hx_merge() to support pseudoknotted helices
    • API: Fix re-use of previous energy parameters upon model changes in duplex.c
    • API: Fix re-use of previous energy parameters upon model changes in c_plex.c
    • API: Fix re-use of previous energy parameters upon model changes in plex.c
    • API: Fix re-use of previous energy parameters upon model changes in ali_plex.c
    • API: Fix re-use of previous energy parameters upon model changes in snofold.c
    • API: Fix re-use of previous energy parameters upon model changes in snoop.c
    • API: Fix mismatch and dangling end energies in sc_cb_mod.c for modified base support
    • API: Fix Zuker-style subopt backtracking
    • API: Fix bug in vrna_strdup_vprintf() that resulted in losing parmeters upon consecutive calls
    • API: Fix default exterior loop MFE soft constraints for comparative structure prediction
    • SWIG: Use av_len() instad of av_top_index() for Perl 5 to support perl5 < v5.18.0
    • SWIG: Fix compilation issues for Python 3.12 due to use of SWIG_Python_str_AsChar()
    • SWIG: Add wrapper for vrna_hx_merge()
    • SWIG: Add wrapper for vrna_sc_multi_cb_add()
    • SWIG: Add wrappers for vrna_hc_add_bp_strand() and vrna_hc_add_up_strand()
    • SWIG: Add file I/O constants
    • SWIG: Add wrappers for structure prediction benchmark functions
    • SWIG: Add wrappers for log message system
    • SWIG: Add wrapper for vrna_stack_prob()
    • SWIG: Add wrappers for new probing data API
    • SWIG: Add wrapper for vrna_n_multichoose_k()
    • SWIG: Return int instead of float for eval_structure_pt_simple()

  • Package

    • AUTOCONF: Fix several autoconf/automake related issues
    • AUTOCONF: Add ./configure --enable-debug option that prevents removal of vrna_log_debug() message from RNAlib
    • Add m5C JSON energy parameter file
    • Add N1-methylpseudouridine JSON energy parameter file
    • Add OpenMP library flags to RNAlib2.pc
    • DOC: Improve document structure
    • Bump libsvm to version 3.35
    • Remove RNA-Tutorial since it is now included as part of the reference manual
    • Remove Python 2 builds from MacOSX installer

Version 2.6.x

2.6.4
  • Programs

    • Fix C++17 compilation issue with kinwalker
    • Fix potential compilation issues with C++20 in RNAforester frontend
    • Refactor and correct spelling issues in man pages for several executable programs

  • Library

    • API: Add shift move support to vrna_move_neighbor_diff*() functions
    • API: Fix char array initialization in snoop.c
    • API: Fix potentially leaking file pointer in vrna_file_msa_read()
    • API: Fix potentially leaking memory in rnaplot_EPS()
    • API: Fix potential use of uninitialized variable in vrna_rotational_symmetry_db_pos()
    • API: Fix soft constraints issue in external loop of vrna_subopt*()
    • SWIG: Add swig class output parameter typemap for Python
    • SWIG: Add __hash__() and __eq__() methods for wrapped _vrna_move_t in Python
    • SWIG: Return var_array objects in Python wrapped vrna_neighbors() and vrna_move_neighbor_diff()
    • SWIG: Refactor file handle wrapping between Python 3 and C
    • SWIG: Fix var_array Python slices and associated memory leak
    • SWIG: Fix bogus delete/free() calls in swig interface
    • Add requirements to build RNAlib with MSVC for Windows
    • Remove unused code in RNApuzzler

  • Package

    • DOC: Transition reference manual from doxygen to sphinx via breathe bridge
    • DOC: Merge documentation of C-API and Python API
    • DOC: Merge parts of tutorial into reference manual
    • AUTOCONF: Refactor autoconf checks for capability to build reference manual
    • AUTOCONF: Deactivate build of RNAxplorer if lapack requirements are not met

2.6.3
  • Library

    • Make JSON parser integral part of ViennaRNA library
    • API: Move modified energy parameters into modified_base object in JSON file(s)
    • SWIG: Enable stand-alone build of Python interface (for PyPI)

  • Package

    • Add enthalpy and terminal end values for predicted stacks with dihydrouridine
    • TESTS: Allow for using pytest to test the Python 3 interface

2.6.2
  • Programs

    • Fix preparation of input sequences for modified base support in RNAcofold

  • Library

    • Fix energy corrections for modified base support when unmodified base is not the same as fallback base, e.g. in the case of inosine
    • Add soft constraints to multifold external loop decomposition
    • Add soft constraints preparation stage callback
    • SWIG: Fix fc.sc_add_bp() propagation of constraint values
    • SWIG: Wrap energy parameter file strings

  • Package

    • TESTS: Add modified base tests on duplex data with I-C and A-Psi pairs from publications

2.6.1
  • Programs

    • Fix double free corruption in RNAdos
    • Fix compilation issues due to use of uint instead of unsigned int for RNAxplorer
    • Fix compilation issues for RNAxplorer when OpenMP is unavailable

  • Package

    • AUTOCONF: Update autoconf macros
    • Update Debian-based packaging rules

2.6.0

This version adds modified base support and a physics-based model to correct energy contributions depending on the concentration of mono-valent ions to our implementations. The new features are fully exposed through the command line tools and the API of RNAlib.

The new implementations for mono-valent ion concentration dependent energy corrections follows the lines of Einert and Netz, 2011, Theory for RNA folding, stretching, and melting including loops and salt., Biophys. J. 100, 2745-2753 (https://doi.org/10.1016/j.bpj.2011.04.038) and is described in Yao et al., 2023, Mono-valent salt corrections for RNA secondary structures in the ViennaRNA package, currently under revision.

The modified base support that is introduced with this release is based on the soft constraints framework and at this time integrates nearest neighbor parameters for the following non-standard nucleotides

  • Inosine
  • Pseudouridine
  • m6A
  • 7-deaza-adenosine (7DA)
  • Purine (aka nebularine)
  • Dihydrouridine
While the first five parameters sets have been determined experimentally through UV-melting, the last, dihydrouridine, has been predicted by us in-silico using the Rosetta/RECESS framework. A paper describing the details of the modified base implementation is in preparation and will be linked here as soon as it is published. See also the man pages of the respective programs implementing modified base support as well as the reference manual.

With this release, we started to automatically convert the documentation for the C-API to Python docstrings. As a consequence, we can now provide a Python API documentation at ReadTheDocs.

With this new release, we deactivated building the Python 2 interface by default. It is still part of the distribution tarball for those that require it but has to be activated via --with-python2 at configure time.

The list of all major changes in this version can be found below:

  • Programs

    • Add modified base input support to RNAfold, RNAplfold, RNALfold, RNAcofold, RNAsubopt
    • Fix missing strand separators in RNAsubopt when applied to multiple interacting sequences
    • Fix sorted output in RNAsubopt with --gquad option
    • Allow for only -Fp in RNAinverse instead of always activating -Fm
    • Fix default value of RNAinverse -R option in manpage
    • Restructure --*help output and man pages for most executable programs
    • Allow for mono-valent ion concentration changes in most executable programs (default 1.021M)
    • Allow for at least as many threads as CPUs are configured if maximum thread number detection fails
    • Fix alignment input parsing in refold.pl
    • Add RNAxplorer program to the distribution

  • Library

    • API: Extend model_details to allow for salt concentration changes
    • API: Add functions for salt concentration change derived energy corrections in ViennaRNA/params/salt.h
    • API: Add arbitrary modified base support (vrna_sc_mod()) via soft constraints mechanism and JSON input data
    • API: Add Pseuoduridine-A parameters via soft constraints callback
    • API: Add Dihydrouridine parameters via soft constraints callback
    • API: Add inosine-U and inosine-C parameters via soft constraints callback
    • API: Add m6A parameters via soft constraints callback mechanism
    • API: Add 7DA modification support via soft constraints
    • API: Add Purine (nebularine) modification support
    • API: Add new soft constraints multi-callback dispatcher
    • API: Add dynamic array data structure utilities
    • API: Add string data structure utilities
    • API: Add vrna_strchr() function
    • API: Fix potential problems in free_dp_matrices() of LPfold.c
    • API: Fix z-score initialization in vrna_Lfoldz() amd vrna_mfe_window_zscore_cb()
    • API: Fix file close issue in vrna_file_commands_read()
    • API: Fix backtracking issue in Zuker subopt
    • API: Fix missing soft constraints callback execution in Zuker subopt
    • API: Fix enumeration of G-quadruplexes in vrna_subopt() and vrna_subopt_cb()
    • API: Fix constraints bug for exterior loop in boltzmann sampling
    • API: Allow for enforcing 'must pair' constraint (|) in dot-bracket constraints strings
    • API: Fix discrepancy between global and local folding in how hard constraints for unpaired bases and non-specific pairing are applied
    • API: Refactor function typdefs to make them actual function pointer typedefs
    • SWIG: Fix Python 3 wrapper suffix issue
    • SWIG: Fix Perl 5 wrapper for vrna_ud_prob_get()
    • SWIG: Only accept upper triangular part of matrix input in fc.sc_bp_add()
    • SWIG: Use var_array instead of tuples for Python RNA.ptable()
    • SWIG: Add Python wrapper for vrna_move_neighbor_diff()
    • SWIG: Add Python docstrings generated from doxygen documentation of C-library

  • Package

    • Update libsvm to version 3.31
    • Update dlib to version 19.24
    • Adapt Debian dependencies
    • Fix compilation issues with RNAforester
    • AUTOCONF: Fix requirement checks when SVM support is deactivated and swig is missing
    • AUTOMAKE: Add auto parameters for -flto compile/link flags
    • AUTOCONF: Require C++17 due to dependencies to compile DLIB
    • AUTOCONF: Deactivate Python 2 bindings by default

Version 2.5.x

2.5.1
  • Programs

    • Refactor ct2db program to allow for pseudoknots in output structure

  • Library

    • API: Fix MEA computation for G-quadruplex predictions
    • API: Fix memory leak in hard constraints container
    • API: Fix RNApuzzler edge-case that resulted in segmentation faults
    • API: Fix invalid memory access in vrna_strjoin()
    • API: Revisit generic soft constraints for sliding-window base pair probability computations
    • API: Enable to overwrite automatic unpaired probability determination in MEA computation
    • API: Add VRNA_PLIST_TYPE_UNPAIRED and VRNA_PLIST_TYPE_TRIPLE identifiers for vrna_ep_t
    • API: Add vrna_init_rand_seed() to initialize RNG with seed
    • API: Add vrna_zsc_compute_raw() to obtain mean and sd for Z-score computation
    • API: Add vrna_file_connect_read_record() function to parse connectivity table (*.ct) files
    • API: Add vrna_strtrim() function
    • API: Update sanity checks for input in vrna_pbacktrack_sub*()
    • API: Allow for pseudo-knots in vrna_db_from_ptable()
    • API: Do not use min_loop_size = 0 for multi strand interaction prediction
    • API: Remove unnecessary uses of min_loop_size at multiple locations
    • API: Deprecate cutpoint member of vrna_fold_compound_t and prepare for 5'/3' encoding
    • API: Refactor sequence addition/preparation for vrna_fold_compound_t
    • DOC: Update documentation
    • SWIG: Add simple dot-plot file wrapper plot_dp_EPS()
    • SWIG: Add sequence, sequence_encoding and sequence_encoding2 attributes to fold_compound objects
    • SWIG: Fix RNG wrapping and initialize RNG upon module load and update associated functions
    • SWIG: Add more access to member variable arrays for various objects used throughout the library
    • SWIG: Add memory efficient wrapper for dynamically allocated arrays and matrices
    • SWIG: Shadow pair table data structure for efficient interactions between C and target languages
    • SWIG: Expose hard constraints members in fold_compound objects
    • SWIG: Add exp_E_ext_stem() method (vrna_exp_E_ext_stem()) to fold_compound objects
    • SWIG: Expose DP matrices within fold_compound objects
    • SWIG: Fix memory leak in wrapper for vrna_db_from_ptable()

  • Package

    • Update dlib to version 19.23
    • DOC: Update doxygen.conf for version 1.9.2
    • AUTOCONF: Factor-out Naview layout algorithm to allow for deactivating the Naview layout algorithm at configure-time
    • AUTOCONF: Make LaTeX checks more portable and update LaTeX package checks
    • AUTOCONF: Check whether we can build the swig interface when SVM support is deactivated
    • AUTOCONF: Fix condition check for CLA build

2.5.0

This version adds multi-strand RNA interaction support to our implementations, exposed to end-users in the form of the novel command line tool RNAmultifold and corresponding changes in the API of RNAlib.

The new implementations for RNA-RNA interaction can now handle multiple RNA input strands that shall form interaction complexes. For that, we implemented a generalization of the concatenation approach of RNAcofold following the ideas of Dirks et al. 2007, Thermodynamic Analysis of Interacting Nucleic Acid Strands, SIAM REVIEW Vol. 49, No. 1, pp. 65-88 https://doi.org/10.1137/060651100 and Lorenz et al., 2021, Efficient Algorithms for Co-Folding of Multiple RNAs, In: Ye X. et al. (eds) Biomedical Engineering Systems and Technologies. BIOSTEC 2020. Communications in Computer and Information Science, vol 1400. Springer, Cham. https://doi.org/10.1007/978-3-030-72379-8_10.

The major new features for multiple interacting RNAs are

  • MFE prediction
  • Partition function and base pair probability computation
  • Equilibrium concentration computation
  • Suboptimal structure enumeration within an energy band around the MFE
  • Suboptimal structure enumeration ala Zuker 1989
  • Free energy evaluation
  • Due to the new implementations, the output order for ensemble free energies of interacting complexes slightly differ between RNAcofold and RNAmultifold with two input sequences. Apart from that, RNAmultifold can be considered a drop-in replacement for RNAcofold.

With this new release, we also adapted the covariance score computation for the prediction of consensus structures of multiple sequence alignments. In particular, the condition that decides which columns of the alignment are allowed to pair was updated to yield more sane results for edge-cases with many gaps and non-canonical base pairs (counter-examples). Therefore, comparing the output of RNAalifold against that of version 2.4.18 or less will most likely result in differences.

This version also makes Python 3 the default Python for the SWIG interface. The only difference you should see, however, is that the source tree changed from directories interfaces/Python and interfaces/Python3 to interfaces/Python and interfaces/Python2. Additionally, we add PDF versions of our contributors license agreement (CLA) to the source code tar-ball.

The list of all major changes in this version can be found below:

  • Programs

    • Add RNAmultifold program to compute secondary structures for multiple interacting RNAs
    • Add multistrand capabilities to RNAeval
    • Add multistrand capabilities to RNAsubopt
    • Replace RNAcofold with a wrapper to RNAmultifold
    • Fix computation of BB homodimer base pair probabilities in RNAcofold

  • Library

    • API: Fix use of undefined values in deprecated function PS_dot_plot()
    • API: Fix probability computations for unstructured domains within multibranch loops
    • API: Fix index error in ensemble defect computations
    • API: Fix hard constraints behavior on non-specific base pairing
    • API: Fix segmentation fault for short input sequences in vrna_hx_from_ptable()
    • API: Fix memory leak in static rna_layout() function
    • API: Fix corner-case in covariance score computation on sequence alignments that determines which alignment columns may pair and which don't
    • API: Add MFE computations for multiple interacting strands
    • API: Add partition function computations for multiple interacting strands
    • API: Add base pair probability computations for multiple interacting strands
    • API: Add suboptimal structure prediction for multiple interacting strands
    • API: Add multistrand capabilities to vrna_eval*() functions
    • API: Add new function vrna_equilibrium_conc() for concentration dependency computations of multiple interacting strands with dlib backend
    • API: Add vrna_equilibrium_constants() function to obtain equilibrium constants for different complexes of multiple interacting strands
    • API: Add function vrna_pf_add() to add ensemble free energies of two ensembles
    • API: Add function vrna_pf_substrands() to get ensemble free energies for complexes up to a specific number of interacting strands
    • API: Add function vrna_n_multichoose_k() to obtain a list of k-combinations with repetition
    • API: Add vrna_cstr_discard() function to allow for discarding char streams prior to flushing
    • API: Add vrna_bp_distance_pt() function to allow for base pair distance computation with pseudo-knots
    • API: Add functions vrna_pbacktrack_sub*() to allow for stochastic backtracing within arbitrary sequence intervals
    • API: Add functions vrna_boustrophedon() and vrna_boustrophedon_pos() to generate lists of or obtain values from sequences of Boustrophedon distributed integer numbers
    • API: Add vrna_pscore() and vrna_pscore_freq() functions to obtain covariance score for particular alignment columns
    • API: Rewrite Zuker suboptimals implementation
    • API: Remove old cofold implementations
    • API: Make type attribute of vrna_mx_mfe_t and vrna_mx_pf_t a constant
    • API: Guard more functions in utils/structure_utils.c against NULL input
    • API: Rename vrna_E_ext_loop() to vrna_eval_ext_stem()
    • API: Use v3 typedefs in dot-plot function declarations
    • SWIG: Fix Python 3 file handle as optional argument in eval* functions and methods
    • SWIG: Add wrapper for vrna_pf_add()
    • SWIG: Add wrapper for vrna_hx_from_ptable()
    • SWIG: Add wrapper for vrna_db_from_probs()

  • Package

    • Update libsvm to version 3.25
    • Make Python 3.x the default Python for the scripting languange interfaces
    • Add Python3 capability for Mac OS X installer builds
    • TESTS: Create TAP driver output for all unit tests (library, executables, SWIG interfaces)
    • Remove compile-time switch to deactivate Boustrophedon backtracing scheme (this is the status-quo now)
    • Add Contributors License Agreement (CLA) to the Package in doc/CLA/

Version 2.4.x

2.4.18
  • Programs

    • Fix and refactor RNApkplex program
    • Fix occasional backtracing errors in RNALalifold
    • Restrict available dangling end models in RNALalifold to 0 and 2
    • Prevent segmentation faults upon bogus input data in RNAfold, RNAalifold, RNAcofold, RNAheat, and RNAeval
    • Free MFE DP matrices in RNAsubopt Boltzmann sampling when not required anymore

  • Library

    • API: Add vrna_abstract_shapes() and vrna_abstract_shapes_pt() functions to convert secondary structures into their respective abstract shape notation ala Giegerich et al. 2004
    • API: Add functions vrna_seq_reverse() and vrna_DNA_complement() to create reverse complements of a sequence
    • API: Add more soft constraint handling to comparative structure prediction
    • API: Add generic soft constraints for sliding window comparative MFE backtracing
    • API: Add vrna_ensemble_defect_pt() that accepts pair table input instead of dot-bracket string to allow for non-nested reference structures
    • API: Add failure/success return values to generic soft constraints application functions
    • API: Refactor RNAPKplex implementation by better using constraints framework and moving out many parts from RNAPKplex.c into RNAlib as separate re-usable functions
    • API: Fix energy contributions used in RNAPKplex implementations
    • API: Fix energy evaluation for cofolding with dangle model 1
    • API: Fix wrong arithmetic usage for PF variant of combined generic and simple soft constraints applied to external loops
    • API: Fix memory size in #vrna_fold_compound_t initialization
    • API: Fix bogus memory access for comparative prediction when preparing hard constraints
    • API: Fix wrong index usage in hard constraints for comparative base pair probability computations of internal loops
    • API: Fix G-Quadruplex contributions as part of multibranch loops in single sequence base pair probability computations
    • API: Fix multibranch loop MFE decomposition step for multiple strand cases
    • API: Fix external loop generic hard constraint index updating for partition function computations
    • API: Fix memory allocation for auxiliary grammar data structure
    • API: Fix incorporation of auxiliary grammar contrib for closing pairs in sliding-window MFE computation
    • API: Fix DP matrix intitialization in sliding window MFE computations (fixes occasional backtracing issues in comparative sliding-window MFE computations)
    • API: Make vrna_sc_t.type attribute a constant
    • API: Remove upper-triangular hard constraint matrix in favor of full matrix
    • API: Always ensure sane base pair span settings after vrna_fold_compound_prepare()
    • API: Return INF on predictions of vrna_mfe_dimer() that fail due to unsatisfiable constraints
    • API: Rename internally used hard and soft constraints API symbols
    • API: Fix header file inclusions to prevent #include cycles
    • SWIG: Add wrapper for vrna_file_fasta_read_record()
    • SWIG: Fix memory leak in wrapper for vrna_probs_window()
    • SWIG: Refactor and therefore fix soft constraint binding functions for use in comparative structure predictions
    • SWIG: Fix typo that prevented properly wrapping vrna_params_load_RNA_Andronescu2007()
    • SWIG: Unify wrappers for vrna_ptable() and vrna_ptable_from_string()

  • Package

    • REFMAN: Refactored structure annotation documentation
    • REFMAN: Update Mac OS X install section
    • Replace DEF placeholders in energy parameter files with their value of -50
    • Update RNAlocmin subpackage to properly compile with more stringent C++ compilers
    • Update RNAforester subpackage to properly compile with more stringent C++ compilers
    • Update autotools framework, e.g. checks for pthreads
    • Update universal binary build instructions for Mac OS X builds to enable ARM compilation for M1 CPUs

  • Source code changes since v2.4.17 are available on Github.
2.4.17
  • Programs

    • Fix RNAup -b mode with shorter sequence first
    • Add --backtrack-global option to RNALfold (currently only available for dangles == 2 | 0)
    • Add --zscore-pre-filter and --zscore-report-subsumed options to RNALfold

  • Library

    • API: Fix multiloop backtracing with soft constraints for unpaired positions in vrna_subopt() and vrna_subopt_cb()
    • API: Fix parameter parse in vrna_params_load_from_string()
    • API: Add vrna_heat_capacity() and vrna_head_capacity_cb() functions to RNAlib
    • API: Add backtracing function vrna_backtrack_window() for global MFE structure to sliding-window predictions
    • API: Add SVG support for RNApuzzler structure layouts
    • API: Make vrna_md_t argument to vrna_fold_compound() a constant pointer
    • API: Remove missing symbols from header file ViennaRNA/params/default.h
    • API: Refactor z-score threshold filter handling for sliding-window MFE prediction
    • SWIG: Fix typo in interface functions to load DNA parameters
    • SWIG: Add python-3.9 autoconf checks
    • SWIG: Add vrna_head_capacity*() wrappers
    • SWIG: Add access to raw energy parameters
    • SWIG: Add alias and pair attribute to objects of type md
    • SWIG: Add out/varout typemaps for 2-dimensional int-like arrays
    • SWIG: Add all data fields to objects of type param and exp_param

  • Package

    • Fix Debian and Windows installer files

2.4.16
  • Programs

    • Fix backtracing errors in RNALalifold for alignments with more than 32768 columns
    • Fix backtracing errors in RNAalifold and RNALalifold for rare cases when two alignment columns may pair due to covariance score threshold but still yield infinite energies due to energy model
    • Refactored manpages/help options for RNAplfold, RNAplot, RNApvmin, RNAsubopt, and RNAup

  • Library

    • API: Fix undefined behavior due to short int overflows when accessing alignment lengths with alignments larger than 32768 columns. This fixes occasional backtracing errors in RNALalifold and vrna_mfe_window()
    • API: Fix adding pscore to base pairs that yield INF energy in comparative global and local MFE prediction
    • API: Add vrna_convert_kcal_to_dcal() and vice-versa function for safely converting integer to float representations of energy values
    • SWIG: Add a reasonable Python interface for objects of type vrna_path_t
    • SWIG: Add a wrapper for vrna_seq_encode()

  • Package

    • Move units.h include file to ViennaRNA/utils/units.h

2.4.15
  • Programs

    • Fix compilation of Kinfold with GCC 10
    • Add --en-only flag to RNAsubopt to allow for sorting by energy only
    • Prevent RNAcofold to process input with more than two strands
    • Add cutpoint marker to dot-plots created with RNAcofold -a
    • Update Kinfold to version 1.4

  • Library

    • API: Fix removal of strand delimiter in vrna_plot_dp_PS_list()
    • API: Fix vrna_enumerate_necklaces()
    • API: Fix bogus backtracing for co-folded structures in vrna_subopt() and vrna_subopt_cb()
    • API: Fix storing co-folded structures for sorted output in vrna_subopt()
    • API: Fix multibranch loop component hard constraints for multi-strand cases
    • API: Prevent adding internal loop energy contributions to enclosed parts with energy=INF
    • API: Adapt vrna_db_pack()/vrna_db_unpack() functions to produce comparable strings
    • API: Add sorting modes VRNA_UNSORTED, VRNA_SORT_BY_ENERGY_LEXICOGRAPHIC_ASC, and VRNA_SORT_BY_ENERGY_ASC to vrna_subopt()
    • API: Add vrna_strjoin() function
    • API: Add missing case to external loop hard constraints
    • API: Make hard constrains strand-aware
    • SWIG: Fix invalid memory access when using MEA_from_plist() in Perl 5 or Python
    • SWIG: Enable keyword argument features in Python interface of constructors for fold_compound, md, move, param, and exp_param objects
    • SWIG: Enable autodoc feature for Python interface of constructors for fold_compound, md, and move objects
    • SWIG: Enable toString conversion for Python interface for objects of type fold_compound, md, move, params, exp_params, and subopt_solution
    • SWIG: Add (read-only) attributes type, length, strands, params, and exp_params to objects of type fold_compound
    • SWIG: Make attributes of objects of type param and exp_param read-only
    • Add array of strand nicks to EPS dot plot files instead of single cutpoint
    • Draw separator line for each strand nick in EPS dot-plots
    • Update libsvm to version 3.24

  • Package

    • Disable Link-Time-Optimization (LTO) for third-party programs linking against RNAlib using pkg-config
    • TESTS: Fix results dir path for out-of-tree builds
    • TESTS: Set default timeout for library tests to 20s

2.4.14
  • Programs

    • Fix RNApvmin pertubation vector computation
    • Add non-redundant sampling option to RNApvmin
    • Add RNAdos program to compute density of states
    • Add -P DNA convenience command line parameter to most programs to quickly load DNA parameters without any input file
    • MAN: Add example section to man-page of RNAalifold

  • Library

    • API: Fix memory leak in vrna_path_gradient()
    • API: Fix release of memory for vrna_sequence_remove_all()
    • API: Fix soft-constraints application in vrna_sc_minimize_pertubation() that prevented proper computation of the pertubation vector
    • API: Add 5' and 3' neighbor nucleotide encoding arrays and name string to vrna_seq_t
    • API: Add new data structure for multiple sequence alignments
    • API: Add vrna_sequence_order_update() function
    • API: Add non-redundant sampling mode to vrna_sc_minimize_pertubation() through passing negative sample-sizes
    • API: Add v3.0 API functions for maximum expected accuracy (MEA) computation
    • API: Include energy parameter sets into RNAlib and provide functions to load them at runtime
    • API: Prepare sequence data in vrna_fold_compound_t with vrna_sequence_add()
    • API: Use vrna_pbacktrack_num() instead of vrna_pbacktrack() in vrna_sc_minimize_pertubation() to speed-up sample generation
    • Reduce use of global variable cut_point in RNAlib
    • SWIG: Use importlib in favor of imp to determine Python 3 tag extension
    • SWIG: Update various wrapper functions
    • SWIG: Add wrappers for MEA computation with vrna_MEA() and vrna_MEA_from_plist
    • SWIG: Add wrappers for vrna_pr_structure() and vrna_pr_energy()

  • Package

    • REFMAN: Fix LaTeX code in units.h that prevented proper compilation with pdflatex
    • Add an R script to create 2D landscape plots from RNA2Dfold output
    • Add gengetopt to configure-time requirements to build man-pages
    • Add new energy parameter file rna_misc_special_hairpins.par with additional UV-melting derived parameters for Tri- and Tetra-loops
    • Update RNA Tutorial
    • Colorize final configure script message
    • REFMAN: Always use pdflatex to compile reference manual and tutorial
    • EXAMPLES: Add Python script that performs computations equivalent to RNAfold -p --MEA

2.4.13
  • Programs

    • Fix centroid structure prediction for RNAcofold
    • Fix --noLP option for RNALalifold

  • Library

    • API: Refactor and fix collision handling in vrna_hash_table_t
    • API: Fix one access using wrong index for odd dangles in loops/external.c
    • API: Add two missing MLbase contributions for MFE prediction in loops/multibranch.c
    • API: Refactor multiloop MFE backtracking for odd dangles
    • API: Add function vrna_backtrack5() to allow for MFE backtracking of sub-sequences starting at the 5'-end
    • API: Reduce usage of global macro TURN by replacing it with min_loop_size field of vrna_md_t
    • API: Add functions vrna_path_direct() and vrna_path_direct_ub() that may also return move lists instead of dot-bracket lists
    • API: Add functions vrna_pt_pk_remove() and vrna_db_pk_remove() that remove pseudoknots from an input structure
    • API: Fix invalid memory access for lonely pair mode (--noLP) in comparative sliding-window MFE prediction
    • SWIG: Fix access to global variable pf_smooth and pf_smooth attribute in model_details object
    • SWIG: Fix Python reference counting for Py_None in interfaces/findpath.i wrapper
    • SWIG: Refactor reference counting for all Python2 and Python3 wrappers
    • REFMAN: Larger updates and restructuring of reference manual

  • Package

    • Install example scripts and source code files, e.g. to $prefix/share/ViennaRNA/examples
    • Properly pass GSL, PTHREADS, and MPFR flags to sub-projects
    • Fix RNApuzzler header file installation
    • SWIG: Include Python 3.7 and 3.8 in list of autoconf-probed python interpreters
    • SWIG: Fix wrapper building for swig >= 4.0.0

2.4.12
  • Programs

    • Add non-redundant stochastic backtracing option for RNAalifold
    • Add --noDP option to suppress dot-plot output in RNAfold and RNAalifold
    • Add RNApuzzler (4) and RNAturtle (3) secondary structure layout algorithm options to RNAfold and RNAplot
    • Update help/man page of RNALfold
    • Allow for multiple input files and parallel input processing in RNAheat

  • Library

    • API: Fix declaration of vrna_move_apply_db()
    • API: Fix vrna_path() lexicographical ordering in gradient walks
    • API: Enable non-redundant stochastic backtracing for comparative structure prediction
    • API: Enable stochastic backtracing for circular comparative structure prediction
    • API: Enable stochastic backtracing of subsequences (5' prefixes) for comparative structure prediction
    • API: Add pf_smooth attribute to vrna_md_t data stucture to allow for disabling Boltzmann factor energy smoothing
    • API: Add functions to allow for resuming non-redundant stochastic backtracing
    • API: Add functions to retrieve multiple stochastically backtraced structures (list and callback variants)
    • API: Add vrna_positional_entropy to compute vector of positional entropies
    • API: Add RNApuzzler and RNAturtle secondary structure layout algorithm (Wiegreffe et al. 2018)
    • API: Add v3.0 API for secondary structure layout/coordinate algorithms
    • API: Add more helper/utility functions for vrna_move_t data structures
    • API: Add callback-based neighborhood update function for (subsequent) vrna_move_t application
    • API: Add abstract heap data structure available as <ViennaRNA/datastructures/heap.h>
    • API: Refactor and speed-up gradient walk implementation available as vrna_path_gradient()
    • API: Substitute vrna_file_PS_aln_sub() alignment plot function by vrna_file_PS_aln_slice() that actually slices out a sub-alignment
    • API: Rename vrna_annotate_covar_struct() to vrna_annotate_covar_db() and add new function vrna_annotate_covar_db_extended() to support more bracket types
    • API: Calling vrna_params_reset() now implies a call to vrna_exp_params_reset() as well
    • API: Move landscape implementations into separate directory, thus headers should be included as <ViennaRNA/landscape/move.h>, <ViennaRNA/landscape/neighbor.h>, etc.
    • Ensure proper rescaling of energy parameters upon temperature changes
    • Refactor soft constraints implementation in stochastic backtracing
    • SWIG: Wrap all non-redundant stochastic backtracing functions to scripting language interface(s)
    • SWIG: Refactor stochastic backtracing interface(s)
    • SWIG: Add proper constructor for objects of type vrna_ep_t
    • SWIG: Sanitize alignment plot function interface(s)

  • Package

    • Update Ubuntu/Debian and OpenSUSE build instructions
    • Reduce intra-package dependency on non-v3.0 API

2.4.11
  • Programs

    • Add --commands option to RNAsubopt
    • Add non-redundant Boltzmann sampling mode for RNAsubopt

  • Library

    • API: Fix wrong access to base pair soft constraints in equilibrium probability computations
    • API: Fix behavior of vrna_nucleotide_encode() with lowercase characters in sequence
    • API: Fix behavior of encode_char() with lowercase characters in sequence
    • API: Fix forbidden GU pairs behavior in pscore computation for comparative folding
    • API: Fix potential errors due to uninitialized next pointers in vrna_move_t of vrna_eval_move_shift_pt
    • API: Add AVX 512 optimized version of MFE multibranch loop decomposition
    • API: Add functions for CPU SIMD feature detection
    • API: Add dispatcher to automatically delegate exterior-/multibranch loop MFE decomposition to supported SIMD optimized implementation
    • API: Add function vrna_dist_mountain() to compute mountain distance between two structures
    • API: Add function vrna_ensemble_defect() to compute ensemble defect given a target structure
    • API: Add non-redundant Boltzmann sampling
    • API: Change behavior of vrna_cstr_free() and vrna_cstr_close() to always flush output before unregistering the stream
    • SWIG: Add interface for vrna_loopidx_from_ptable()

  • Package

    • Activate compilation for compile-time supported SIMD optimized implementations by default
    • Replace --enable-sse configure script option with --disable-simd

2.4.10
  • Programs

    • Fix wrong output filename for binary opening energies in RNAplfold
    • Enable G-Quadruplex support for partition function computation in RNAalifold

  • Library

    • Fix broken SSE4.1 support for multibranch loop MFE computation that resulted in increased run times
    • Fix redundant output issue in subopt backtracking with unusually high delta energies (≥INF)
    • Restore default behavior of '|' symbol in dot-bracket hard constraint strings that got lost with version 2.2.0
    • Add faster (cache-optimized) version of Nussinov Maximum Matching algorithm
    • Change default linker- and loop length computations for G-Quadruplex predictions in comparative prediction modes
    • Add hard constraints warning for base pairs that violate the min_loop_size of the model
    • Update libsvm to version 3.23
    • API: Add functions to set auxiliary grammar extension rules
    • API: Replace upper-triangular hard constraints matrix with full matrix for cache-optimized access
    • API: Add G-Quadruplex prediction support for comparative partition function
    • API: Remove VRNA_GQUAD_MISMATCH_PENALTY and VRNA_GQUAD_MISMATCH_NUM_ALI macros
    • SWIG: Fix invalid memory access in subopt() method of fold_compound object when writing to file
    • SWIG: Add wrapper for Nussinov Maximum Matching algorithm

  • Package

    • Add -ftree-vectorize compile flag by default if supported

2.4.9
  • Programs

    • Fix interactive mode behavior for multiple sequence alignment input in RNAalifold, RNALalifold
    • Allow for Stockholm formatted multiple sequence alignment input in RNAeval and RNAplot
    • Allow for multiple input files in RNAeval and RNAplot
    • Allow for parallel processing of input batch jobs in RNAeval and RNAplot
    • Add -g / --gquad option to activate G-Quadruplex support in RNAheat
    • Warn on unsatisfiable hard constraints from dot-bracket string input in RNAfold, RNAcofold, and RNAalifold

  • Library

    • Fix parameter order bug in vrna_path_findpath* functions that resulted in too large search widths
    • Fix wrong application of base pair soft constraints in partition function computations
    • Fix position ruler string in EPS alignment output files
    • Fix MFE backtracking errors that might appear under specific hard constrained base pair patterns
    • Complete soft constraints additions to Boltzmann sampling implementation for single sequences
    • API: Refrain from reading anything other than #=GC SS_cons to retrieve structures when parsing Stockholm 1.0 format
    • API: Allow for disabling alignment wrapping in vrna_file_PS_aln* functions
    • API: Do not remove G-Quadruplex annotation from WUSS formatted structure strings upon calls to vrna_db_from_WUSS()
    • API: Enable G-Quadruplex related average loop energy correction terms in verbose output of vrna_eval_* functions
    • API: Speed-up backward compatibility layer for energy evaluation functions that unnecessarily slowed down third-party tools using the old API
    • API: Allow for passing dot-bracket strings with & strand-end identifier to simple vrna_eval_* functions
    • API: Remove implicit exit() calls from global MFE backtracking implementation.

2.4.8
  • Programs

    • Fix compilation of RNAforester with C++17 standard
    • Fix tty input detection in RNAcofold
    • Fix bad memory access with RNAcofold -p

  • Library

    • API: Fix incorrect unpaired probability computations in vrna_probs_window()
    • API: Fix potential out-of-bounds access situations (for circular RNA folding) in eval.c
    • API: Fix comparative exterior internal loop partition function computation for circfold
    • SWIG: Fix false-positive use of uninitialized value in Python3/file_py3.i

  • Package

    • TESTS: Add tests for special features in RNAalifold
    • TESTS: Add test case for RNAcofold -p

2.4.7
  • Programs

    • Allow for parallel processing across multiple input files in RNAfold
    • Allow for arbitrary number of input files in RNAalifold
    • Allow for parallel processing of input data in RNAalifold
    • Allow for arbitrary number of input files in RNAcofold
    • Allow for parallel processing of input data in RNAcofold
    • Enable parallel processing in RNAfold, RNAcofold, RNAalifold for MS Windows build
    • Add centroid and MEA structure computation to RNAcofold
    • Include ligand binding energies in centroid and MEA structure output of RNAfold
    • Refactor ct2db program to process multiple structures from single .ct file

  • Library

    • API: Enable processing of comparative fold_compound with vrna_pr_*() functions
    • API: Refactor vrna_ostream_t to enable NULL input in vrna_ostream_provide()
    • API: Major refactoring in loop energy evaluations (MFE and PF)
    • API: Make vrna_mx_pf_aux_el_t and vrna_mx_pf_aux_ml_s opaque pointers
    • API: Make fold_compound field type a const attribute
    • API: Refactor MFE post-processing for circular RNAs
    • API: Add motif name/id support for unstructured domains
    • API: Remove major part of implicit exit() calls in RNAlib
    • API: Add implementations of Boyer-Moore-Horspool search algorithm
    • API: Add implementations to determine number of rotational symmetry for strings (of objects)
    • API: Make vrna_cmd_t an opaque pointer
    • API: Move headers for constraints, datastructures, io, loop energy evaluation, energy parameters, plotting, search, and utilities into separate subdirectories (backward compatibility is maintained)
    • API: Add hash table data structure
    • API: Fix discrepancy between comparative and single sequence --noLP predictions
    • API: Add functions to replace 'old API' interface of RNAstruct.h
    • API: Add functions to replace 'old API' interface of aln_util.h
    • API: Add generic soft constraints support to suboptimal structure prediction sensu Wuchty et al.
    • SWIG: Refactor callback execution for Python 2 / 3 interface to reduce overhead
    • SWIG: Fix configure-time check for Python 3 interface build
    • SWIG: Fix Python 3 IO file stream to C FILE * conversion

  • Package

    • Add configure time check for LTO capabilities of the linker
    • Cosmetic changes in final configure notice
    • Major changes in source tree structure of the library
    • Add autoconf checks for maintainer tools
    • Generate C strings from static PostScript files at configure time (for structure- and dot plots)
    • REFMAN: Large updates in API documentation and structure of reference manual

2.4.6

This version fixes two regressions in comparative structure prediction.

In particular, we adapt the computation of base pairing probabilities and Boltzmann sampling to the changes introduced with Version 2.4.4, and restore dot-bracket based hard constrained base pairs that got lost with Version 2.4.2.

  • Programs

    • Stabilize rounding of free energy output in RNAalifold

  • Library

    • API: Fix potential rounding errors for comparative free energies in eval.c and mfe.c
    • API: Fix regression in exterior loop dangling end contributions for comparative base pair probabilities and Boltzmann sampling
    • API: Fix regression with hard constrained base pairs for comparative structure prediction

  • Package

    • TESTS: Add basic tests for RNAalifold executable
    • TESTS: Ignore 'frequency of MFE structure' in RNAcofold partition function checks

2.4.5
  • Programs

    • Allow for arbitrary number of input files in RNAfold
    • Allow for parallel processing of input data in RNAfold (unavailble for Windows platform)
    • Add SHAPE reactivity support through commandline options for RNAplfold
    • Fix unstructured domain motif detection in MFE, centroid, and MEA structures computed by RNAfold
    • Limit allowed set of commands in command file for RNAcofold to hard and soft constraints

  • Library

    • API: Add functions to compute equilibrium probability of particular secondary structures
    • API: Add dynamic string stream data type and associated functions
    • API: Add priority-queue like data structure with unordered fill capability and ordered output callback execution
    • API: Add functions to detect unstructured domain motifs in MFE, centroid, and MEA structures
    • API: Fix bug in sliding-window partition function computation with SHAPE reactivity and Deigan et al. conversion method
    • API: Fix application of '<' and '>' constraint symbols in dot-bracket provided constraints
    • API: Fix MEA structure computation in the presence of unstructured domains
    • API: Stabilize order of probability entries in EPS dot-plot files
    • Fix compiler warnings on wrong type of printf() in naview.c
    • Define VRNA_VERSION macro as string literal and add macros for major, minor, and patch numbers
    • SWIG: Fix 'next' is a perl keyword warnings for Perl5 wrapper
    • SWIG: Catch errors and throw execptions whenever scripting language provided callback functions are not applicable or fail
    • SWIG: Add keyword arguments and autodoc feature for Python/Python3 wrappers

  • Package

    • Stabilize parallel make of Mac OS X installer
    • Add energy parameter set from Langdon et al. 2018
    • Add autoconf checks for POSIX threads compiler/linker support

2.4.4

This version introduces a correction with respect to the handling of dangling end contributions in exterior loops when computing the partition function for multiple sequence alignments!
Therefore, the ensemble free energies and equilibrium probabilities computed with programs such as RNAalifold and RNAplfold may slightly differ compared to previous versions.

The above correction can briefly be described as a harmonization of the partition function model compared to the MFE implementation, where end-gaps in the alignment can never contribute any stability to helices branching off the exterior loop.

  • Programs

    • Change verbose output for soft-constraints derived ligand binding motifs in RNAfold
    • Allow for lowercase letters in ct2db input
    • Fix annotation of PostScript output for soft-constraint derived ligand binding motifs in RNAfold
    • Fix sporadic segmentation faults for RNAsubopt in cofold mode

  • Library

    • Add simplified interface for vrna_pf_dimer()
    • Add new API functions for exterior loop evaluations
    • Add simplified interfaces for energy evaluation with G-Quadruplexes and circular RNAs
    • Add vrna_path_findpath() functions that allow for specification of an upper bound for the saddle point
    • Add automatic CPP suggestions for deprecated function substitutes
    • Fix dangling end contributions in comparative partition function for exterior loops
    • Fix bug in interior-like G-Quadruplex MFE computation for single sequences
    • Fix bug in eval_int_loop() that prevented propagation of energy evaluation for loops with nick in strands
    • Fix several bugs for SHAPE reactivity related comparative partition function computations
    • Fix constraint indices for multibranch loops in unpaired probability computations of LPfold.c
    • Move concentraton dependent implementation for co-folding to separate compile unit
    • Major restucturing and constraints feature additions in loop type dependent energy evaluation functions
    • Major restructuring in MFE implementations
    • Major restructuring in PF implementations
    • Minor fixes in Boltzmann sampling implementation
    • SWIG: Fix wrappers for vrna_path_findpath() implementation
    • SWIG: Add tons of energy evaluation wrappers
    • SWIG: Fix configure-time check of Perl5 interface build capabilities
    • SWIG: Wrap functions from walk.c and neighbor.c
    • SWIG: Add configure-time linker check for Python3 interface

  • Package

    • Add some missing references to manpages of executable programs
    • Heavy re-ordering of the RNAlib reference manual
    • Fix autoconf switch to enable deprecation warnings

2.4.3
  • Programs

    • Add --pf_scale commandling parameter to RNAplfold
    • Prevent RNAplfold from creating inf/-inf output when solution set is empty with particular hard constraints
    • Include RNAforester v2.0.1 (minor changes in code base to make modern compilers happier)
    • Fix probability computation for stochastic backtracking in RNAsubopt --stochBT_en output

  • Library

    • Add constraint framework for single sequence circular RNA structure prediction
    • Stabilize partition function scaling by always using sfact scaling factor from model details
    • Fix handling of dangling end contribution at sequence boundaries for sliding window base pair probability computations
    • Fix handling of base pair hard constraints in sliding-window implementations
    • Fix sliding-window pair probability computations with multibranch-loop unpaired constraints
    • Fix sliding-window non-specific base pair hard constraint implementation
    • Fix regression in comparative structure prediction for circular RNAs

  • Package

    • Add RNAfold test suite to check for working implementation of constraints for circular RNAs
    • Add a brief contribution guideline CONTRIBUTING.md
    • Fix LDFLAGS for scripting language interfaces in corresponding Makefiles

2.4.2
  • Programs

    • Fix regression in RNAup unstructuredness and interaction energy computations
    • Fix build problems of RNAlocmin with older compilers
    • Fix bad memory access in RNAsubopt with dot-bracket constraint
    • Add full WUSS support for --SS_cons constraint option in RNAalifold
    • Add commandline option to RNALalifold that enables splitting of energy contributions into separate parts
    • Add CSV output option to RNAcofold
    • Use the same model details for SCI computations in RNAalifold
    • Use original MSA in all output generated by RNAalifold and RNALalifold

  • Library

    • Fix G-Quadruplex energy corrections in comparative structure energy evaluations
    • Fix discrepancy in comparative exterior loop dangling end contribution of eval vs. MFE predictions
    • Fix sequence length confusions when FASTA input contains carriage returns
    • Fix sliding-window hard constraints where single nucleotides are prohibited from pairing
    • Fix dot-bracket output string length in sliding-window MFE with G-Quadruplexes
    • Fix unpaired probability computations for separate individual loop types in LPfold.c
    • Add missing hard constraint cases to sliding-window partition function implementation
    • Abort computations in vrna_eval_structure_v() if structure has unexpected length
    • API: Add new functions to convert dot-bracket like structure annotations
    • API: Add various new utility functions for alignment handling and comparative structure predictions
    • API: Add function vrna_strsplit() to split string into tokens
    • API: Do not convert sequences of input MSA to uppercase letters in vrna_file_msa_read_record()
    • API: Rename vrna_annotate_bp_covar() and vrna_annotate_pr_covar()
    • API: Add new noLP neighbor generation
    • SWIG: Add wrapper for functions in file_utils_msa.h
    • SWIG: Add wrappers for vrna_pbacktrack() and vrna_pbacktrack5()
    • SWIG: Add vrna_db_to_element_string() to scripting language interface

  • Package

    • REFMAN: Fix formula to image conversion in HTML output

2.4.1
  • Programs

    • Regression: Fix homo-dimer partition function computation in RNAcofold
    • Add SHAPE reactivity support to RNAcofold
    • Add SHAPE reactivity support to RNALalifold

  • Library

    • Regression: Fix reverting pf_scale to defaults after vrna_exp_params_rescale()
    • Fix memory leak in SWIG generated fold_compound methods returning dot-bracket strings
    • Fix memory leaks in double ** returning functions of SWIG Perl5 interface
    • Fix memory leak in vrna_ep_t.__str__() function of SWIG interface

  • Package

    • Add unit tests for RNAcofold executable

2.4.0

This version adds hard/soft constraints support for our implementations of sliding-window structure prediction as used in the executable programs RNALfold and RNAplfold.

Together with the new feature of hard- and soft-constraints for sliding-window structure prediction we unified and corrected the implementations used in the tools RNALfold, RNALalifold, and RNAplfold.

The major changes are

  • All the above tools now use the same definition of maximum base pair span.
    This means that for a maximum base pair span of L the recursions only consider base pairs (i, j) with (j - i + 1) ≤ L.
  • Locally optimal structures that are part of another, larger locally optimal structure are filtered out.
    This mainly affects the output of RNALfold that sometimes did not filter properly. Note, however, that filtering is only performed for consecutive hits!. Thus, it may still happen that locally optimal substructures appear in the output.
  • Locally optimal structure must not be branched in the exterior loop.
    This rule was not considered in the output of RNALalifold and thus has a large impact on the hits obtained from that tool.

Therefore, comparing the output of the above tools against that of version 2.3.5 or less will most likely result in differences.

This version also adds a new software sub-package, RNAlocmin. Detailed information on this tool can be obtained here. Additionally, we also add a PDF version of the RNA Bioinformatics tutorial as available on our homepage to the default instalation target.

The list of all major changes in this version can be found below:

  • Programs

    • Print G-Quadruplex corrections in verbose mode of RNAeval
    • Change behavior of RNAfold --outfile option to something more predictable
    • Unify max_bp_span usage among sliding window prediction algorithms: RNAplfold, RNALfold, and RNALalifold now consider any base pair (i,j) with (j - i + 1) <= max_bp_span
    • Add SHAPE reactivity data support to RNALfold
    • Add commands-file support for RNALfold, RNAplfold (hard/soft constraints)
    • Fix regression for --canonicalBPonly switch in RNAfold/RNAcofold/RNAsubopt
    • Fix Alidot link in RNAalifold manpage
    • Restore capability to compile stand-alone findpath utility

  • Library

    • Add hard constraints to sliding-window MFE and PF implementations
    • Add soft constraints to sliding-window MFE and PF implementation for single sequences
    • Add SWIG interfaces for sliding-window MFE/PF implementations
    • Add proper SWIG interface for alignment and structure plotting functions
    • Add proper SWIG interface for duplexfold, duplex_subopt, and its comparative variants
    • Add SWIG wrapper for vrna_exp_params_rescale()
    • Add explicit destructor for SWIG generated vrna_md_t objects
    • Add SWIG perl5 typemap for simple nested STL vectors
    • Add dummy field in vrna_structured_domains_s
    • Add SWIG interface for findpath implementation
    • Add prepare() functions for ptype-arrays and vrna_(exp_)param_t
    • Add warnings for ignored commands in function vrna_commands_apply()
    • Add callback featured functions for sliding window MFE and PF implementations
    • Change default behavior of adding soft constraints to a vrna_fold_compound_t (store only)
    • Several fixes with respect to G-Quadruplex prediction in sliding-window MFE recursions (single sequence and comparative implementation)
    • Replace comparative sliding-window MFE recursions (All hits are reported to callback and can be filtered in a post-processing step)
    • API: Remove E_mb_loop_stack() and introduce new function vrna_E_mb_loop_stack() as a replacement
    • API: change data type of all constraint bit-flags from char to unsigned char
    • API: change data type of a2s array in comparative structure prediction from unsigned short to unsigned int
    • API: Change function parameter order in vrna_probs_window() to follow the style of other callback-aware functions in RNAlib
    • Move sliding-window MFE implementations to new file mfe_window.c
    • Fix redefinition of macro ON_SAME_STRAND() in subopt.c
    • Fix dangling end issues in sliding-window MFE implementations
    • Fix building sliding-window MFE implementation without SVM support
    • Fix parsing of STOCKHOLM 1.0 MSA files that contain MSA spanning multiple blocks
    • Fix buffer overflow in hairpin loop sequence motif extraction for circular RNAs
    • Fix out-of-bounds memory access in neighbor.c
    • Restore capability to use non-standard alphabets for structure prediction
    • Restore old-API random number functions in SWIG interface
    • Allow additional control characters in MAF MSA input that do not end a block
    • Make functions in pair_mat.h static inline
    • Prevent users from adding out-of-range base pair soft constraints
    • Inline print functions in color_output.inc
    • Introduce state flag in vrna_sc_s

  • Package

    • Bump libsvm to version 3.22
    • Add RNAlocmin - Calculate local minima from structures via gradient walks
    • Add RNA Bioinformatics tutorial (PDF version)
    • Add note about SSE optimized code in reference manual
    • Fix building PDF Reference manual with non-standard executable paths
    • Fix wrong pre-processor flags when enabling single-precision PF computations
    • Fix unit testing perl5 interface by including builddir/tests in PERL5LIB path
    • General improvements in reference manual
    • Remove obsolete scripts ct2b.pl and colorrna.pl from src/Utils directory
    • Remove old RNAfold tutorial

Version 2.3.x

2.3.5
  • Programs

    • Fix duplication of output filename prefix in RNAfold
    • Add G-Quadruplex prediction to RNALalifold
    • Enable users to turn-off base pair probability computations in RNAcofold with -a option

  • Library

    • Add V3.0 API for sliding window partition function (a.k.a. RNAPLfold)
    • Add SWIG wrappers for callback-based sliding window comparative MFE prediction
    • Add SSE4.1 multiloop decomposition for single sequence MFE prediction (Thanks to W. B. Langdon)
    • Split move set in neighbor.c

  • Package

    • Enable RNAfold unit tests to run in paralllel

2.3.4
  • Programs

    • Fix double-free when using SHAPE reactivity data in RNAalifold
    • Fix z-score output in RNALfold
    • Enhance auto-id feature in executable programs
    • Always sanitize output file names to avoid problems due to strange FASTA headers
    • Lift restrictions of FASTA header length in RNAfold, RNAcofold, and RNAeval
    • Add test-suite for RNAfold
    • Enable RNALalifold to read Clustal/Stockholm/FASTA/MAF alignments in batch-mode
    • Add parameter option to RNALalifold for colored EPS alignment and structure plot output
    • Add parameter option to RNALalifold to write hits into Stockholm file
    • Add parameter option to RNAalifold to write Stockholm 1.0 formatted output
    • Add parameter option to RNAalifold to suppress stderr spam
    • Add auto-id feature to RNAplot, RNALfold, RNAsubopt, RNAplfold, RNAheat
    • Add SHAPE reactivity derived pseudo-energies as separate output in RNAalifold
    • Add colored terminal output to RNA2Dfold, RNALalifold, RNALfold, RNAduplex, RNAheat, RNAinverse, RNAplfold, and RNAsubopt
    • Add command line parameters to RNAsubopt to allow for specification of input/output files

  • Library

    • Fix G-Quadruplex global probability computation for single sequences
    • Fix out-of-bounds access in strand_number array
    • Implement sane weighting of SHAPE reactivity data in consensus structure prediction when fewer data than sequences are present
    • Substitute field name A0,B0 in data structure vrna_dimer_conc_s by Ac_start,Bc_start to avoid clashes with termios.h (Mac OSX Python wrapper bug)
    • Add ViennaRNA/config.h with pre-processor definitions of configure time choices
    • Add functions to procude colored EPS structure alignments
    • Add function to write Stockholm 1.0 formatted alignments
    • Add function to sanitize file names
    • Add callback based implementation for sliding-window MFE prediction (single sequences, comparative structure prediction)
    • Add fast API 3.0 implementations to generate structural neighbors and perform steepest descent / random walks

  • Package

    • Minimize usage of 'unsafe' sprintf() calls

2.3.3
  • Library

    • Fix bug in multiloop contributions for comparative partition function

  • Package

    • Fix building python2 extension module for OSX

2.3.2
  • Programs

    • Fix behavior of RNAplfold for unusually short RNAs
    • Report SCI of 0 in RNAalifold when sum of single sequence MFEs is 0

  • Library

    • Fix pair probability plist creation with G-Quadruplexes
    • Fix init of vrna_md_t data structure after call to set_model_details()
    • Fix bug in consensus partition function with hard constraints that force nucleotides to be paired
    • Enable generic hard constraints by default
    • Fix init of partition function DP matrices for unusually short RNAs
    • Prevent multiple includes of pair_mat.h

  • Package

    • Allow for specification of python2/3-config at configure time
    • Fix compilation of functions that use ellipsis/va_list
    • Add configure flag to build entirely static executables

2.3.1
  • Programs

    • Add unstructured domain feature example to RNAfold manpage

  • Library

    • Fix regression in vrna_md_update() that resulted in incomplete init of reverse-basepair type array (mainly affectingRNAalifold)
    • Fix scaling of secondary structure in EPS plot such that it always fits into bounding box
    • Several fixes and improvements for SWIG generated scripting language interface(s)
    • Extend coverage of generic hard constraints for partition function computations
    • Add missing newline in non-TTY-color output of vrna_message_info()
    • Add description for how to use unstructured domains through command files to reference manual

  • Package

    • Fix compilation issue for Windows platforms with MingW

2.3.0

This version introduces the first transitions towards a more flexible, callback-function based RNA secondary structure decomposition.

The so-called unstructured domains feature extends the RNA folding grammar with alternative handling of self-enclosed unpaired stretches in an RNA structure. This enables one, for instance, to model protein binding to single stranded sequence motifs, while addressing the competition between base pairing and binding affinity of the ligand. The entire extension is not only available using our RNAlib C-library, but also through the Perl and Python scripting interfaces. The program RNAfold already includes a convenience method to add unstructured domain sequence motifs and their corresponding binding free energy through easy-to-use command files.

For further details, we refer to our publication "RNA folding with hard and soft constraints", the section on Unstructured Domains and Domain extensions commands of the RNAlib reference manual, and the manpage of RNAfold.

  • Programs

    • Introduced command files that subsume constraint definition files (RNAfold and RNAcofold)
    • Replace explicit calls to (non-portable) asprintf() with portable equivalent functions in the library
    • Fix regression that prevented several programs to fail on too long input sequences
    • Extend EPS dot-plot in RNAfold to include motif/binding probabilities from unstructured domains
    • Add ID manipulation feature to RNAeval

  • Library

    • Introduce grammar extension through structured and unstructured domains
    • Add unstructured domains feature in MFE, partition function, and equilibrium probability computations for single RNA sequences
    • Add default implementation for unstructured domains to allow for ligand/protein binding to unpaired structure segments (MFE and PF for single sequences)
    • Added utility functions that deal with conversion between different units
    • Bugfix in SWIG wrapped generic soft constraint feature
    • Add subopt() and subopt_zuker() methods to SWIG wrapped fold_compound objects
    • Fix multiloop decomposition in MFE for circular RNAs
    • Add separate function to compute pscore for alignments
    • Renamed VRNA_VC_TYPE_* macros to VRNA_FC_TYPE_*
    • Add variadic functions for error/warning/info message
    • Extend API for soft constraint feature for more fine-grained control
    • Fix bug in interior loop computations when hard constraints result in non-canonical base pairs
    • Restructured reference manual
    • Add section on SWIG wrapped functions in reference manual

  • Package

    • Fix configure script to deal with situations where Perl module can't be build
    • Fix bug in doc/Makefile.am that prevented HTML installation due to long argument list

Version 2.2.x

2.2.10
  • Programs

    • Fix bad memory access that occasionally occured in RNAsubopt with sorted output

  • Library

    • Fix bad memory access in vrna_subopt() with sorted output
    • Do not 'forget' subopt results when output is not written to file handle and sorting is switched off
    • Add SWIG wrappers for vrna_subopt_cb()

  • Package

    • Correctly show if C11 features are activated in configure status
    • Fix autoconf checks to allow for cross compilation again

2.2.9
  • Programs

    • Add various new commandline options to manipulate sequence/alignment IDs in RNAfold, RNAcofold and RNAalifold
    • Fix bug for temperature setting in RNAplfold
    • Enable RNAalifold to use Clustal, Stockholm, FASTA, or MAF alignments as input
    • Lift restriction of sequence number in alignments for RNAalifold
    • Enable ANSI colors for TTY output in RNAfold, RNAcofold, RNAalifold, RNAsubopt

  • Library

    • Fix bug in hard constraints usage of exterior loop MFE prediction with odd dangles
    • Fix order of hard constraints when read from input file
    • Fix several hard constraint corner-cases in MFE and partition function computation when nucleotides must not be unpaired
    • Fix bug in partition function scaling for backward compatibility of ali_pf_fold()
    • Fix interpretation of 'P' hard constraint for single nucleotides in constraint definition files
    • Add 'A' command for hard constraints in hard constraints definition files
    • Stabilize v3.0 API when building RNAlib and third party program linking against it with compilers that use different C/C++ standards
    • Use -fflat-lto-objects for static RNAlib library to allow linking without LTO
    • Add parsers for Clustal, Stockholm, FASTA, and MAF formatted alignment files
    • Allow for non-canonical base pairs in MFE and partition function computations if hard constraints demand it
    • Enable ANSI colors for TTY output for warnings/errors issued by RNAlib

  • Package

    • Add details on how to link against RNAlib to the reference manual

2.2.8
  • Programs

    • Fix bad memory access in RNAalifold
    • Fix regression in RNAalifold to restore covariance contribution ratio determination for circular RNA alignments
    • Changed output of RNAsubopt in energy-band enumeration mode to print MFE and energy range in kcal/mol instead of 10cal/mol
    • Include latest Kinfold sources that make use of v3.0 API, therefore speeding up runtime substantially
    • Re-activate warnings in RNAeval when non-canonical base pairs are encountered

  • Library

    • Fix syntactic incompatibilities that potentially prevented compilation with compilers other than gcc
    • Add function to compare nucleotides encoded in IUPAC format
    • Fix regression in energy evaluation for circular RNA sequences
    • Fix regression in suboptimal structure enumeration for circular RNAs
    • Allow for P i-j k-l commands in constraint definition files
    • Make free energy evaluation functions polymorphic
    • Add free energy evaluation functions that allow for specifying verbosity level
    • Secure functions in alphabet.c against NULL pointer arguments
    • Fix incompatibility with swig ≥ 3.0.9
    • Fix memory leak in swig-generated scripting language interface(s) for user-provided target language soft-constraint callbacks
    • Expose additional functions to swig-generated scripting language interface(s)
    • Build Python3 interface by default
    • Start of more comprehensive scripting language interface documentation
    • Fix linking of python2/python3 interfaces when libpython is in non-standard directory

  • Package

    • Restructured viennarna.spec for RPM based distributions
    • Several syntactic changes in the implementation to minimize compiler warnings
    • Fix --with-*/--without-* and --enable-*/--disable-* configure script behavior

2.2.7
  • Programs

    • Fix partition function scaling for long sequences in RNAfold, RNAalifold, and RNAup
    • Fix backtracking issue in RNAcofold when --noLP option is activated

  • Library

    • Fix hard constraints issue for circular RNAs in generating suboptimal structures

  • Package

    • Rebuild reference manual only when actually required

2.2.6
  • Programs

    • Plugged memory leak in RNAcofold
    • Fixed partition function rescaling bug in RNAup
    • Fixed bug in RNALfold with window sizes larger than sequence length
    • Re-added SCI parameter for RNAalifold
    • Fixed backtracking issue for large G-quadruplexes in RNAalifold
    • Fixed missing FASTA id in RNAeval output
    • Added option to RNAalifold that allows to specify prefix for output files

  • Library

    • Several fixes and additional functions/methods in scripting language interface(s)
    • Added version information for scripting language interface(s)
    • Some changes to allow for compilation with newer compilers, such as gcc 6.1

2.2.5
  • Programs

    • Fixed regression in RNAcofold that prohibited output of concentration computations
    • Fixed behavior of RNAfold and RNAcofold when hard constraints create empty solution set (programs now abort with error message)

  • Library

    • Added optional Python 3 interface
    • Added RNA::Params Perl 5 sub-package
    • Update RNA::Design Perl 5 sub-package
    • Simplified usage of v3.0 API with default options
    • Wrap more functions of v3.0 API in SWIG generated scripting language interfaces
    • Plugged some memory leaks in SWIG generated scripting language interfaces
    • Changed parameters of recursion status callback in vrna_fold_compound_t
    • Enable definition and binding of callback functions from within SWIG target language

  • Package

    • Added optional subpackage Kinwalker
    • Added several configure options to ease building and packaging under MacOS X
    • Added new utility script RNAdesign.pl

2.2.4
  • Programs

    • Fixed bug in RNAsubopt that occasionally produced cofolded structures twice

  • Library

    • Removed debugging output in preparations of consensus structure prediction datastructures

2.2.3
  • Programs

    • Added postscipt annotations for found ligand motifs in RNAfold
    • Added more documentation for the constraints features in RNAfold and RNAalifold

  • Library

    • Restore backward compatibility of get_alipf_arrays()

2.2.2
  • Programs

    • Fix regression bug that occasionally prevented backtracking with RNAcofold --noLP

2.2.1
  • Programs

    • Fix regression bug that made RNAcofold -a unusable
    • Fix regression bug that prohibited RNAfold to compute the MEA structure when G-Quadruplex support was switched on
    • Fix bug in Kinfold to enable loading energy parameters from file
    • Fix potential use of uninitialized value in RNApdist
    • Add manpage for ct2db

  • Library

    • Fix MEA computation when G-Quadruplex support is activated

  • Package

    • Allow for vendor installation of the perl interface using INSTALLDIRS=vendor at configure time
    • Install architecture dependent and independent files of the perl and python interface to their correct file system locations

2.2.0

This version introduces tons of new features. First of all, the new hard- and soft-constraints allow for easy manipulation of the prediction recursions. For instance, SHAPE reactivity data can be directly converted to soft-constraints and readily used in MFE, and partition function computations. Ligand binding to hairpins and interior loops with specific sequence/structure motifs, e.g. accessible through RNAfold, is another feature that became possible due to the new constraints framework.

Most of the new features we've implemented into RNAlib require specific new functions that, partially, replace already existing ones. Therefore, with this version, we start introducing the new v3.0 API, that will eventually replace the one currently existing. All functions of the new API are now prefixed with vrna_ that not only makes them easily recognizable, but also provides some sort of namespacing that helps in the development of third-party programs linking agains RNAlib.
Through usage of a generic data structure for all secondary structure prediction algorithms, most functions that implement a special algorithm, such as MFE, or partition function, are now polymorphic. Thus, there is only one single function in the interface that can deal with multiple variations of input, such as single sequences or sequence alignments.
However, we will maintain complete backward compatibility until v3 of the ViennaRNA Package.

We also started to make the new API accessible through the Perl and Python interface, where we introduce a new object-oriented way to use the RNAlib.

Please see the RNAlib Reference Manual, and the individual manpages of the executable programs in the ViennaRNA Package for further details on new features, and feature changes.

  • Programs

    • RNAforester is now of version 2.0
    • New program RNApvmin to compute pseudo-energy pertubation vector that minimizes discrepancy between observed and predicted pairing probabilities
    • SHAPE reactivity support for RNAfold, RNAsubopt, and RNAalifold
    • Ligand binding to hairpin- and interior-loop motif support in RNAfold
    • New commandline option to limit maximum base pair span for RNAfold, RNAsubopt, RNAcofold, and RNAalifold
    • Bugfix in RNAheat to remove numerical instabilities
    • Bugfix in RNAplex to allow for computation of interactions without length limitation
    • Bugfix in RNAplot for simple layouts and hairpins of size 0

  • Library

    • (generic) hard- and soft-constraints for MFE, partition function, base pair probabilities, stochastic backtracking, and suboptimal secondary structures of single sequences, sequence alignments, and sequence dimers
    • libsvm version as required for z-scoring in RNALfold is now 3.20
    • Stochastic backtracking for single sequences is faster due to usage of Boustrophedon scheme
    • First polymorphic functions vrna_mfe(), vrna_pf(), and vrna_pbacktrack().
    • The FLT_OR_DBL macro is now a typedef
    • New functions to convert between different secondary structure representations, such as helix lists, and RNAshapes abstractions
    • First object-oriented interface for new API functions in the scripting language interfaces
    • new ViennaRNA-perl submodule that augments the Perl interface to RNAlib
    • Ligand binding to hairpin- and interior-loop motif support in C-library and scripting language interfaces.

  • Package

    • Libraries are generated using libtool
    • Linking of libraries and executables defaults to use Link Time Optimization (LTO)
    • Large changes in directory structure of the source code files

Version 2.1.x

2.1.9

This version fixes a major bug in the energy evaluation of exterior loops and multibranch loops!

In previous versions of the ViennaRNA Package starting with version 2.0, the energy contributions for dangling ends and terminal mismatches of exterior- and multibranch loops were not applied correctly. This problem appeared due to a defective parser that converts the Turner 2004 energy parameters into ViennaRNA code. Therefore, if you compare predictions, e.g. from RNAfold 2.1.9, with those of versions prior to 2.1.9, they may differ. In general, the differences in predicted structures and energies should be very small. However, it may happen that results are totally different.

To assess the impact of the fixed energy parameter usage we re-ran all benchmarks as applied for the original publication of The ViennaRNA Package 2.0. The resulting performance measures suggest, that the impact is actually very small, although predictions seem to be slightly better with version 2.1.9.
See the ViennaRNA Package 2.0 - Performance page for details.

  • Programs

    • Fixed integer underflow bug in RNALfold
    • Added Sequence Conservation index (SCI) option to RNAalifold

  • Library

    • Fixed bug in energy evaluation of dangling ends / terminal mismatches of exterior loops and multibranch loops
    • Fixed bug in alifold partition function for circular RNAs
    • Fixed bug in alifold that scrambled backtracing with activated G-Quadruplex support
    • Fixed bug in alifold backtracking for larger G-Quadruplexes

  • Utils

    • Avoid warning for missing sequence constraint in switch.pl

2.1.8
  • Programs

    • Repaired incorporation of RNAinverse user provided alphabet
    • Fix missing FASTA ID in RNAeval output

  • Library

    • prevent race condition in parallel calls of Lfold()
    • Fixed memory bug in Lfold() that occured using long sequences and activated G-Quad support

  • Utils

    • Added latest version of switch.pl

2.1.7
  • Programs

    • Fixed bug in RNALfold -z

  • Library

    • Python and Perl interface are compiling again under MacOSX. See Install Notes.
    • Fixed handling of C arrays in Python interface

  • Utils

    • Added latest version of switch.pl
    • Make relplot.pl work with RNAcofold output

2.1.6
  • Programs

    • New commandline switches allow for elimination of non-canonical base pairs from constraint structures in RNAfold, RNAalifold and RNAsubopt

  • Library

    • updated moveset functions
    • final fix for discrepancy of tri-loop evaluation between partition function and mfe
    • pkg-config file now includes the OpenMP linker flag if necessary

  • Utils

    • New program ct2db allows for conversion of .ct files into dot-bracket notation (incl. pseudo-knot removal)

2.1.5
  • Library

    • Fix for discrepancy between special hairpin loop evaluation in partition functions and MFE

2.1.4
  • Library

    • Fix of G-quadruplex support in subopt()
    • Fix for discrepancy between special hairpin loop evaluation in partition functions and MFE

2.1.3
  • Programs

    • RNAfold: Bugfix for ignoring user specified energy parameter files
    • RNAcofold: Bugfix for crashing upon constrained folding without specifying a constraint structure
    • RNAsubopt: Added G-quadruplex support
    • RNAalifold: Added parameter option to specify base pair probability threshold in dotplot

  • Library

    • Fix of several G-quadruplex related bugs
    • Added G-quadruplex support in subopt()

2.1.2
  • Programs

    • RNAfold: Bugfix for randomly missing probabilities in dot-plot during batch job execution
    • RNAeval: Bugfix for misinterpreted G-quadruplex containing sequences where the quadruplex starts at nucleotide 1
    • RNAsubopt: Slight changes to the output of stochastic backtracking and zuker subopt

  • Library

    • Fix of some memory leaks
    • Bugfixes in zukersubopt(), assign_plist_from_pr()
    • New threadsafe variants of putoutpU_prob*() for LPfold()
    • Provision of python2 interface support. This interface is very basic at the moment and the configure script default is to disable it. If you want to try it out, use it at your own risk. Comments and remarks about usability are welcome.

2.1.1
  • Library

    • Bugfix to restore backward compatibility with ViennaRNA Package 1.8.x API (this bug also affected proper usage of the the perl interface)

2.1.0

The ViennaRNA Package was recently extended to take a certain class of higher-order structure motifs, so called G-quadruplexes, into account, too.

This is the recursion scheme that we use to predict these structure motifs:

G-quadruplex predictions are marked by the character "+" in the extended dot-parenthesis notation output. Thus, RNAfold output may look like

$ echo "GGCUGGUGAUUGGAAGGGAGGGAGGUGGCCAGCC" | Progs/RNAfold -g
GGCUGGUGAUUGGAAGGGAGGGAGGUGGCCAGCC
((((((..........++.++..++.++)))))) (-21.39)

Here, the four consecutive stretches of "+" mark the G-G interactions within the G-quadruplex. On calculation of base pairing probabilities, the dot-plot output of RNAfold contains the Boltzmann probabilities of a G-quadruplex delimited by sequence position i and j, depicted by a green triangle, as well as the individual G-G interaction probabilities displayed like canonical base pair interactions.
Calculation of the base pair probabilities for the above example then results in a dot-plot like this

References for this new feature:
"RNA Folding Algorithms with G-Quadruplexes" - Ronny Lorenz, Stephan H. Bernhart, Fabian Externbrink, Jing Qin, Christian Höner zu Siederdissen, Fabian Amman, Ivo L. Hofacker and Peter F. Stadler, Advances in Bioinformatics and Computational Biology, Lecture Notes in Computer Science, 7409, (2012) page(s) 49-60, Publisher: Springer Berlin / Heidelberg, Editor(s): Marcilio de Souto and Maricel Kann
  • Programs

    • G-Quadruplex support in RNAfold, RNAcofold, RNALfold, RNAalifold, RNAeval and RNAplot
      This introduces a new commandline option '--gquad/-g' that enables G-quadruplex prediction. The dot-bracket notation for the structure output now contains an additional character '+' that indicates the presence of such a G-tetrad. Consecutive '+' signs always come in sets of 4 interspaced by some '.', marking the four G-runs and its linker sequences that comprise the quadruplex, respectively.
    • changes in RNAPKplex behavior and commandline options
    • new features and bugfixes in RNAplex and RNAsnoop
    • warning messages for all programs if an unsupported dangle option is selected

  • Library

    • LPfold got a new option to output its computations in split-mode
    • several G-Quadruplex related functions were introduced with this release
    • several functions for moves in an RNA landscape were introduced
    • new function in alipfold.c now enables access to the partition function matrices of alipf_fold()
    • different numeric approach was implement for concentration dependend co-folding to avoid instabilities which occured under certain circumstances

  • Utils

    • To enable fast plotting of RNA2Dfold output we now also provide two gri-scripts "2Dlandscape_mfe.gri" and "2Dlandscape_pf.gri".
      To use them, simply redirect the output of RNA2Dfold into a text file and then call the appropriate script with the RNA2Dfold output filename as first parameter, e.g.:

      $ ./2Dlandscape_mfe.gri my_2Dfold_output.txt

      This will create a postscript file named "my_2Dfold_output.txt.ps" that displays the MFE output in a nice landscape like manner
    • The Utils script "relplot.pl" got a new commandline option "-a" that enables annotation of the accessibility in the structure plot

  • Package

    • The auxilary energy parameter files in the source tree now reside in the 'misc' directory.
      They are, however, still installed at the same locations as in previous versions of the Package.
    • Some changes in the build process now enable easier cross compilation of the Package
    • The example sourcecode in the reference manual got an update to comply with the specifications of ViennaRNA Package 2.x

Version 2.0.x

2.0.7
  • Programs

    • Bugfix for RNAplfold where segfault happened upon usage of -O option
    • Corrected misbehavior of RNAeval and RNAplot in tty mode

2.0.6
  • Programs

    • Bugfix for bad type casting with gcc under MacOSX (resulted in accidental "sequence too long" errors)
    • Bugfix for disappearing tri-/hexaloop contributions when read in from certain parameter files
    • Bugfix for RNALfold that segfaulted on short strange sequences like AT+ repeats
    • Change of RNA2Dfold output format for stochastic backtracking

2.0.5
  • Programs

    • Restored z-score computation capabilities in RNALfold

2.0.4
  • Programs

    • Bugfix for RNAcofold partition function

  • Library

    • Perl wrapper compatibility to changed RNAlib has been restored
    • Backward compatibility for partition function calls has been restored [under certain circumstances under-/overflows in the calculations of pf_fold(), alipf_fold(), co_pf_cold() and pfl_fold() appeared in version 2.0.3]

2.0.3
  • Programs

    • Bugfix for RNAalifold partition function and base pair probabilities in v2.0.3b
    • Added Boltzmann factor scaling in RNAsubopt, RNAalifold, RNAplfold and RNAcofold

  • Library

    • Bugfix for alipfold() in v2.0.3b
    • Restored threadsafety of folding matrix access in LPfold.c, alipfold.c, part_func.c, part_func_co.c and part_func_up.c
    • Added several new functions regarding threadsafe function calls in terms of concurrently changing the model details. The new functions with the suffix '_par' may now be used to pass an energy contribution datastructure filled with additional information about the model details. In this way, seperation from the global variables

      dangles, noLonelyPairs, noGU, no_closingGU, tetra_loop, temperature, logML

      is possible. Furthermore, the new functions also provide detachement from the global variables

      do_backtrack, fold_constrained

      This works for all implementations in
      • fold.c
      • part_func.c
      • LPfold.c
      • alipfold.c

      Basic support is provided in
      • cofold.c
      • part_func_co.c
      • subopt.c

      However, since all cofolding functions currently rely on the global variable 'cut_point', they are not considered really threadsafe yet, i.e. a change in the cut_point while concurrent calculations take place will result in unpredictable results!

      Threadsafety of the remaining functions, regarding the above mentioned global variables will be incoorporated in upcoming versions

      See the reference manual of the RNAlib for more details (params.h, part_func.h, etc.)

  • Package

    • Added pkg-config file in the distribution to allow easy checks for certain RNAlib2 versions, compiler flags and linker flags. This makes linking of third party programs agains RNAlib2 much more easier.
      E.g. a call of 'pkg-config --modversion RNAlib2' reveals the version of the installed RNAlib. Developers who use autoconf may now take advantage of the different PKG_ macros to retrieve version, linker and compiler flags

2.0.2
  • Programs

    • added support for Boltzmann factor scaling in RNAfold
    • fixed fastaheader to filename bug

  • Library

    • plugged some memory leaks

2.0.1
  • Package

    • First official release of version 2.0
    • included latest bugfixes

History

  • 09.05.2011

    Fixed file name issue that occured under HFS on MacOS X (unbelievably HFS is not capable to distinguish files solely based on the case of the letters in the filename)

  • 18.04.2011

    Fixed RNAcofold bug (memory corruption when two complementary sequences form a full length helix)

  • 17.03.2011

    Fixed RNAsubopt bug (invalid free() appeared sometimes depending on compiler used)

  • 10.03.2011

    Replaced calls to non-ANSI function strndup() to ensure compatibility with MacOS X and FreeBSD

  • 07.03.2011

    Fixed RNAup bug (interaction mode might have taken wrong sequence as target in batch mode)