BARRIERS
NAME
barriers − manual page for barriers 1.8.1
SYNOPSIS
barriers [OPTION]... [[FILE]]...
DESCRIPTION
barriers 1.8.1
Compute local minima and energy barriers of a landscape
This program reads an energy sorted list of conformations of a landscape, and computes local minima and energy barriers of the landscape. For RNA secondary structures, suitable input is produced by RNAsubopt. For each local minimum found it prints to stdout, the conformation of the minimum, its energy, the number of the "parent"−minimum it merges with, and the height of the energy barrier. Additional information on each minimum, such as saddle point conformation and basin sizes can be included via options.
A PostScript
drawing of the resulting tree is written to
"tree.ps" in the current directory.
−h, −−help
Print help and exit
−−detailed−help
Print help, including all details and hidden options, and exit
−−full−help
Print help, including hidden options, and exit
−V, −−version
Print version and exit
General Options:
Command line options which alter the general behavior of this program.
−v, −−verbose
Be verbose, i.e. print more information. (default=off)
−q, −−quiet
Be quiet (also inhibit PS tree output). (default=off)
Graphs and Move Sets:
The graph and move set options specify the types of states/conformations in the system as well as their neighborhood. Some graphs provide different neighborhood settings. The type of landscape may also be set by the input file using the fourth word on first line. E.g.:
AUCGUGAGCUGUGUAGCUUAGCUAGCUAGC −610 100 :: RNA−noLP
for a landscape of canonical RNA structures.
−G, −−graph=Graph
Define type of the graph, i.e. configuration space. (default=‘RNA’)
The configuration space (graph) determines the neighborhood of the system and can be any of the following types:
’RNA’: RNA secondary structures
’RNA−noLP’: canonical RNA structures
’RNA2’: RNA secondary structures
’RNA2−noLP’: canonical RNA structures, no lonely pairs
’Q2’: Spin Glass (strings of "+−")
’Qa,ALPHA’: a−letter Hamming graph, e.g. Q3 strings of "ABC". ALPHAbet is
optional, default is ’ABC...’
’T’: Phylogenetic Treesin bracket notation, e.g. "((1)(((2)(3))(5))(4))"
’P’: Permutations as comma separated list, e.g. 5,1,4,2,3
’X’: Exchange Moves on balances +/− strings
’?’: General graph; adjacency list in file
−M, −−moves=STRING
Select the move−set for generating neighbors of a configuration (if Graph allows several different ones).
The available move sets heavily depend on the choice of the graph. For RNA structures, the available move sets are:
’[no]Shift’: (Dis−)allow shift moves. (default: noShift)
’ligand’: RNA−ligand/protein interaction
For permutation graphs, the possible move sets are:
’T’: for Transpositions (default)
’C’: for Canonical Transpositions
’R’: for Reversal moves.
Spin Glass graphs provide the two move sets:
’p’: point mutations, i.e. single spin flip (default), and
’c’: flip 2nd half.
Trees always use NNI (Nearest Neighbour Interchange).
−−poset=INT
Input is a poset from n objective functions. (default=‘0’)
Barrier Tree
Computation:
−c, −−connected
Restrict the output to the connected component. (default=off)
Depending on the input data, the corresponding barrier tree(s) might not be connected, i.e. the internal representation actually is a barrier forest. Enabling this option will restrict the output to the one connected component the ground state belongs to. In case there are multiple ground states that belong to different trees, the first (according to the input order) will be selected. Note, that restricting the rate computation to the connected component also ensures that the rate matrix is ergodic.
−−bsize
Print the size of of each basin in output. (default=off)
−−ssize
Print saddle component sizes. (default=off)
−−max=INT
Compute only the lowest <num> local minima. (default=‘100’)
−−minh=<delta>
Print only minima with energy barrier greater than delta. (default=‘0.000001’)
−−saddle
Print the saddle point conformations in output. (default=off)
Transition
Rate Computation:
−−rates
Compute rates between macro states (basins). (default=off)
Two output files are written, "rates.out" containing the rates in ASCII format and "rates.bin" in binary form. Both output files can be readily used in conjunction with the treekin program.
−−rates−text−file=<filename>
Specify file name for the rates output.
(default=‘rates.out’)
−−rates−binary−file=<filename>
Specify file name for the binary rates output.
(default=‘rates.bin’)
−−noLP−rate=DOUBLE
Scale rates of double moves for RNA−noLP (e.g. 0.01). (default=‘1.0’)
−−microrates
Compute microscopic rates between connected states. (default=off)
−T, −−temp=DOUBLE
Set temperature in degree centigrade. (default=‘37.0’)
This temperature is used to compute Boltzmann fators in conjunction with −−rates option.
Miscellaneous
Options:
−P,
−−path=<l1>=<l2>
Backtrack an optimal path between local minimum l2 and l1.
The option can be specified multiple times and each path will be written to a corresponding file "path.l1.l2.txt".
−−mapstruc=<filename>
Map conformations to minima in the tree.
Once the barrier tree (and optionally rates) are constructed , read stuctures from "filename" and map them to their corresponding minima (macro states). Output is written to file "mapstruc.out" in table format with the following columns:
1: gradient_min
2: index_in_subopt
3: energy
4: basin
5: truebasin
6: gradient_basin
7: true_grad_basin
The last number is probably what you want, true basins are those that fulfill the minh criterium.
−−mapstruc−output=<file>
Specify the filename for structure mapping output. (default=‘mapstruc.out’)
REFERENCES
Ch. Flamm, I.L. Hofacker, P.F. Stadler, M.T. Wolfinger. "Barrier trees of degenerate landscapes" Z. Phys. Chem., 216:155−173 (2002)
Ligand support has been added with version 1.7.0, see
M.T. Wolfinger, Ch. Flamm, I.L. Hofacker "Efficient computation of cotranscriptional RNA-ligand interaction dynamics" Methods, (2018)
AUTHOR
Ivo Hofacker, Christoph Flamm, Peter Stadler, Michael T. Wolfinger
SEE ALSO
RNAsubopt(1),treekin(1)


